TSC22D4-TSC22 domain family, member 4 Gene View larger

TSC22D4-TSC22 domain family, member 4 Gene

PTXBC001486

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSC22D4-TSC22 domain family, member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSC22D4-TSC22 domain family, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001486
Product type: DNA & cDNA
Ncbi symbol: TSC22D4
Origin species: Human
Product name: TSC22D4-TSC22 domain family, member 4 Gene
Size: 2ug
Accessions: BC001486
Gene id: 81628
Gene description: TSC22 domain family, member 4
Synonyms: THG-1; THG1; TILZ2; TSC22 domain family protein 4; TSC22-related-inducible leucine zipper protein 2; tsc-22-like protein THG-1; TSC22 domain family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgggggcaagaagaagagtagtttccaaatcaccagcgtcaccacggactatgagggccctgggagcccaggggcttcggatccccctaccccacagcccccaaccgggcccccgccccgcctgcccaatggggagcccagccccgatccggggggcaagggcaccccccggaatggctccccaccacctggggccccttcctcccgtttccgggtggtgaagctgccccacggcctgggagagccttatcgccgcggtcgctggacgtgtgtggatgtttatgagcgagacctggagccccacagcttcggcggactcctggagggaattcgaggggcctcagggggcgccgggggcagatctttggattccaggttggagctggccagcctcggcctgggcgcccccaccccaccgtcaggcctgtctcagggccccacctcctggctccgtccaccccccacctctcctggacctcaggcccgctccttcactgggggactgggccagctggtggtgcccagcaaagccaaggcagagaaacccccactgtcggcctcctcaccccagcagcgccccccagagcctgagaccggtgagagtgcgggcacatcccgggctgccacgcccctgccctctctgagggtggaagcggaggctgggggctcaggggccaggacccctccactgtcccggaggaaagctgtagacatgcggctgcggatggagttgggtgctccagaagagatggggcaggtgcccccacttgactctcgccccagctccccggccctctacttcacccacgatgccagcctggttcacaaatctccagaccccttcggagcagtagcagctcagaagttcagcctggcccactccatgttggccatcagtggtcacctagacagcgacgatgatagtggctccggaagcctggttggcattgacaacaaaatcgagcaagccatggacttggtgaagtcccacctcatgtttgcggtccgggaggaggtggaggtgctgaaggagcagatccgggaactggcggagcggaacgctgcgctggagcaggagaatgggctgctgcgcgccctggccagcccggagcagctggctcagctgccctcctcgggggtcccacggcttgggccccctgcgcccaatgggccctccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tripartite motif-containing 13
- abhydrolase domain containing 3
- interleukin 11 receptor, alpha
- plasminogen activator, urokinase

Buy TSC22D4-TSC22 domain family, member 4 Gene now

Add to cart