TRIM13-tripartite motif-containing 13 Gene View larger

TRIM13-tripartite motif-containing 13 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIM13-tripartite motif-containing 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRIM13-tripartite motif-containing 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003579
Product type: DNA & cDNA
Ncbi symbol: TRIM13
Origin species: Human
Product name: TRIM13-tripartite motif-containing 13 Gene
Size: 2ug
Accessions: BC003579
Gene id: 10206
Gene description: tripartite motif-containing 13
Synonyms: E3 ubiquitin-protein ligase TRIM13; CAR; DLEU5; LEU5; RNF77; B-cell chronic lymphocytic leukemia tumor suppressor Leu5; CLL-associated RING finger; RING finger protein 77; leukemia-associated protein 5; ret finger protein 2; tripartite motif protein 13; tripartite motif-containing protein 13; tripartite motif containing 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgcttgaagaagatctcacatgccctatttgttgtagtctgtttgatgatccacgggttttgccttgctcccacaacttctgcaaaaaatgcttagaaggtatcttagaagggagtgtgcggaattccttgtggagaccagctccattcaagtgtcctacatgccgtaaggaaacttcagctactggaattaatagcctgcaggttaattactccctgaagggtattgtggaaaagtataacaagatcaagatctctcccaaaatgccagtatgcaaaggacacttggggcagcctctcaacattttctgcctgactgatatgcagctgatttgtgggatctgtgctactcgtggggagcacaccaaacatgtcttctgttctattgaagatgcctatgctcaggaaagggatgcctttgagtccctcttccagagctttgagacctggcgtcggggagatgctctttctcgcttggataccttggaaactagtaagaggaaatccctacagttactgactaaagattcagataaagtgaaggaattttttgagaagttacaacacacactggatcaaaagaagaatgaaattctgtctgactttgagaccatgaaacttgctgttatgcaagcatatgacccagagatcaacaaactcaacaccatcttgcaggagcaacggatggcctttaacattgctgaggctttcaaagatgtgtcagaacccattgtatttctgcaacagatgcaggagtttagagagaaaatcaaagtaatcaaggaaactcctttacctccctctaatttgcctgcaagccctttaatgaagaactttgataccagtcagtgggaagacataaaactagtcgatgtggataaactttctttgcctcaagacactggcacattcattagcaagattccctggagcttttataagttatttttgctaatccttctgcttggccttgtcattgtctttggtcctaccatgttcctagaatggtcattatttgatgacctggcaacttggaaaggctgtctttcaaacttcagttcctatctgactaaaacagccgatttcatagaacaatcagttttttactgggaacaggtgacagatgggtttttcattttcaatgaaagattcaagaattttactttggtggtactgaacaatgtggcagaatttgtgtgcaaatataaactattataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 3
- interleukin 11 receptor, alpha
- plasminogen activator, urokinase
- inositol hexaphosphate kinase 1

Buy TRIM13-tripartite motif-containing 13 Gene now

Add to cart