MAEA-macrophage erythroblast attacher Gene View larger

MAEA-macrophage erythroblast attacher Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAEA-macrophage erythroblast attacher Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAEA-macrophage erythroblast attacher Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001225
Product type: DNA & cDNA
Ncbi symbol: MAEA
Origin species: Human
Product name: MAEA-macrophage erythroblast attacher Gene
Size: 2ug
Accessions: BC001225
Gene id: 10296
Gene description: macrophage erythroblast attacher
Synonyms: EMLP; EMP; GID9; HLC-10; PIG5; macrophage erythroblast attacher; GID complex subunit 9, FYV10 homolog; cell proliferation-inducing gene 5 protein; erythroblast macrophage protein; human lung cancer oncogene 10 protein; lung cancer-related protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgaaggtccaggagtacccgaccctcaaggtgccctacgagacgctgaacaaacgctttcgcgccgctcagaagaacattgaccgggagaccagccacgtcaccatggtggtggccgagctggagaagacgttgagcggctgccccgccgtggactccgtggtcagcctgctggacggcgtggtggagaagctcagcgtcctcaagaggaaggcggtggaatccatccaggccgaggacgagagcgccaagctgtgcaagcgccggatcgagcacctcaaagagcatagcagcgaccagcccgcggcggccagcgtgtggaagaggaagcgcatggatcgcatgatggtggagcacctgctgcgttgcggctactacaacacggctgtcaagctggcgcgccagagcggcatcgaggacctagtgaatattgagatgttcctgacggccaaagaggtggaggagtccctggagaggcgtgagacggccacctgcctggcctggtgccatgacaacaagtcccggctccggaagatgaagagctgcctggagttcagcctcagaatccaggagttcattgaactcatccggcagaataagagactggacgctgtgagacatgcaagaaagcacttcagccaagcagaagggagccagctggacgaggtgcgccaggccatgggcatgctggccttcccgcccgacacgcacatctccccgtacaaggaccttctggaccctgcacggtggcggatgctgatccagcagttccggtacgacaactaccgactacaccagctgggaaacaattctgtgttcaccctcaccctgcaggccggcctctcagccatcaagacaccacagtgctacaaggaggacggcagctccaagagccctgactgccctgtgtgcagccgctccctgaacaagctggcgcagcccctgcccatggcccactgtgccaactcccgcctggtctgcaagatttctggcgacgtgatgaacgagaacaatccgcccatgatgctgcccaacggctacgtctacggctacaattctctgctttctatccgtcaagatgataaagtcgtgtgcccgagaaccaaagaagtcttccacttctcacaagccgagaaggtgtacatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TSC22 domain family, member 4
- TSC22 domain family, member 4
- TSC22 domain family, member 4
- tripartite motif-containing 13

Buy MAEA-macrophage erythroblast attacher Gene now

Add to cart