Login to display prices
Login to display prices
MAEA-macrophage erythroblast attacher Gene View larger

MAEA-macrophage erythroblast attacher Gene

PTXBC001225

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAEA-macrophage erythroblast attacher Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAEA-macrophage erythroblast attacher Gene

Proteogenix catalog: PTXBC001225
Ncbi symbol: MAEA
Product name: MAEA-macrophage erythroblast attacher Gene
Size: 2ug
Accessions: BC001225
Gene id: 10296
Gene description: macrophage erythroblast attacher
Synonyms: EMLP; EMP; GID9; HLC-10; PIG5; macrophage erythroblast attacher; GID complex subunit 9, FYV10 homolog; cell proliferation-inducing gene 5 protein; erythroblast macrophage protein; human lung cancer oncogene 10 protein; lung cancer-related protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgaaggtccaggagtacccgaccctcaaggtgccctacgagacgctgaacaaacgctttcgcgccgctcagaagaacattgaccgggagaccagccacgtcaccatggtggtggccgagctggagaagacgttgagcggctgccccgccgtggactccgtggtcagcctgctggacggcgtggtggagaagctcagcgtcctcaagaggaaggcggtggaatccatccaggccgaggacgagagcgccaagctgtgcaagcgccggatcgagcacctcaaagagcatagcagcgaccagcccgcggcggccagcgtgtggaagaggaagcgcatggatcgcatgatggtggagcacctgctgcgttgcggctactacaacacggctgtcaagctggcgcgccagagcggcatcgaggacctagtgaatattgagatgttcctgacggccaaagaggtggaggagtccctggagaggcgtgagacggccacctgcctggcctggtgccatgacaacaagtcccggctccggaagatgaagagctgcctggagttcagcctcagaatccaggagttcattgaactcatccggcagaataagagactggacgctgtgagacatgcaagaaagcacttcagccaagcagaagggagccagctggacgaggtgcgccaggccatgggcatgctggccttcccgcccgacacgcacatctccccgtacaaggaccttctggaccctgcacggtggcggatgctgatccagcagttccggtacgacaactaccgactacaccagctgggaaacaattctgtgttcaccctcaccctgcaggccggcctctcagccatcaagacaccacagtgctacaaggaggacggcagctccaagagccctgactgccctgtgtgcagccgctccctgaacaagctggcgcagcccctgcccatggcccactgtgccaactcccgcctggtctgcaagatttctggcgacgtgatgaacgagaacaatccgcccatgatgctgcccaacggctacgtctacggctacaattctctgctttctatccgtcaagatgataaagtcgtgtgcccgagaaccaaagaagtcttccacttctcacaagccgagaaggtgtacatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: