CCDC108-coiled-coil domain containing 108 Gene View larger

CCDC108-coiled-coil domain containing 108 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC108-coiled-coil domain containing 108 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC108-coiled-coil domain containing 108 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031585
Product type: DNA & cDNA
Ncbi symbol: CCDC108
Origin species: Human
Product name: CCDC108-coiled-coil domain containing 108 Gene
Size: 2ug
Accessions: BC031585
Gene id: 255101
Gene description: coiled-coil domain containing 108
Synonyms: CCDC108; cilia- and flagella-associated protein 65; coiled-coil domain containing 108; cilia and flagella associated protein 65
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcacccaggctccaagctccgtcgtgaggtccaggaacagcaggaaccacaccgtgaactctggtggatcctgcctgagtgccagcacagtggccatccctgccatcaacgacagcagtgcagccatgagtgcctgcagcaccatcagcgcccagcccgcaagctccatggacactcagatgcactccccaaagaagcaggagagagtgaacaagagggtcatctggggcattgaggtggctgaggagctgcattggaaaggctgggagctaggaaaggagaccacaaggaatctggttctgaaaaatcgatccttgaaactccagaagatgaagtacaggtaccagtataagggatcaaggacccagtgccacagccttgagccccgaaagcaggctctcttcaaaacaaaacaaaacaaacaaaaaaaacctttaacatgccatataaaagccagtgagtgtttaaaatacatgcagtatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin regulatory light chain MRCL3
- pyrroline-5-carboxylate reductase 1
- myosin regulatory light chain MRCL3
- regulator of G-protein signaling 10

Buy CCDC108-coiled-coil domain containing 108 Gene now

Add to cart