Login to display prices
Login to display prices
PYCR1-pyrroline-5-carboxylate reductase 1 Gene View larger

PYCR1-pyrroline-5-carboxylate reductase 1 Gene

PTXBC022244

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PYCR1-pyrroline-5-carboxylate reductase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PYCR1-pyrroline-5-carboxylate reductase 1 Gene

Proteogenix catalog: PTXBC022244
Ncbi symbol: PYCR1
Product name: PYCR1-pyrroline-5-carboxylate reductase 1 Gene
Size: 2ug
Accessions: BC022244
Gene id: 5831
Gene description: pyrroline-5-carboxylate reductase 1
Synonyms: ARCL2B; ARCL3B; P5C; P5CR; PIG45; PP222; PRO3; PYCR; pyrroline-5-carboxylate reductase 1, mitochondrial; P5C reductase 1; proliferation-inducing protein 45; pyrroline-5-carboxylate reductase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcagctgctgagcagcgtgggcttctgcacggaggtggaagaggacctgattgatgccgtcacggggctcagtggcagcggccccgcctacgcattcacagccctggatgccctggctgatgggggtgtgaagatgggacttccaaggcgcctggcagtccgcctcggggcccaggccctcctgggggctgccaagatgctgctgcactcagaacagcacccaggccagctcaaggacaacgtcagctctcctggtggggccaccatccatgccttgcatgtgctggagagtgggggcttccgctccctgctcatcaacgctgtggaggcctcctgcatccgcacacgggagctgcagtccatggctgaccaggagcaggtgtcaccagccgccatcaagaagaccatcctggacaaggtgaagctggactcccctgcagggaccgctctgtcgccttctggccacaccaagctgctcccccgcagcctggccccagcgggcaaggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice