Login to display prices
Login to display prices
ICA1L-islet cell autoantigen 1,69kDa-like Gene View larger

ICA1L-islet cell autoantigen 1,69kDa-like Gene

PTXBC000993

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICA1L-islet cell autoantigen 1,69kDa-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ICA1L-islet cell autoantigen 1,69kDa-like Gene

Proteogenix catalog: PTXBC000993
Ncbi symbol: ICA1L
Product name: ICA1L-islet cell autoantigen 1,69kDa-like Gene
Size: 2ug
Accessions: BC000993
Gene id: 130026
Gene description: islet cell autoantigen 1,69kDa-like
Synonyms: ALS2CR14; ALS2CR15; islet cell autoantigen 1-like protein; Ica69-related protein; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 14 protein; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 15 protein; islet cell autoantigen 1,69kDa-like; islet cell autoantigen 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattcctttgggcaacccagaccagaagataatcagtcagtagtcagaagaatgcaaaagaaatactggaaaactaaacaggtctttatcaaagcaacaggaaaaaaagaggatgagcacttggtggcgtctgatgctgaactggatgctaaacttgaggtttttcactctgttcaagagacatgcactgaacttctgaagataatcgagaaataccagctaagactcaatgttatatcagaggaagaaaatgagctagggctctttttaaaatttcaagcagaacgggatgcaactcaagctggcaaaatgatggatgccactggcaaggcactttgttcttcagccaagcaaagattggccctgtgtactcctctgtctcgtctgaagcaagaagtagcaacattcagtcaaagggcagtatctgataccttgatgacaattaatcggatggagcaggcacgcacagaatacagaggagctctactgtggatgaaagatgtatcccaagagctggacccagacaccttaaagcaaatggaaaagtttagaaaagtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice