Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ICA1L-islet cell autoantigen 1,69kDa-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ICA1L-islet cell autoantigen 1,69kDa-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000993 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ICA1L |
| Origin species: | Human |
| Product name: | ICA1L-islet cell autoantigen 1,69kDa-like Gene |
| Size: | 2ug |
| Accessions: | BC000993 |
| Gene id: | 130026 |
| Gene description: | islet cell autoantigen 1,69kDa-like |
| Synonyms: | ALS2CR14; ALS2CR15; islet cell autoantigen 1-like protein; Ica69-related protein; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 14 protein; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 15 protein; islet cell autoantigen 1,69kDa-like; islet cell autoantigen 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattcctttgggcaacccagaccagaagataatcagtcagtagtcagaagaatgcaaaagaaatactggaaaactaaacaggtctttatcaaagcaacaggaaaaaaagaggatgagcacttggtggcgtctgatgctgaactggatgctaaacttgaggtttttcactctgttcaagagacatgcactgaacttctgaagataatcgagaaataccagctaagactcaatgttatatcagaggaagaaaatgagctagggctctttttaaaatttcaagcagaacgggatgcaactcaagctggcaaaatgatggatgccactggcaaggcactttgttcttcagccaagcaaagattggccctgtgtactcctctgtctcgtctgaagcaagaagtagcaacattcagtcaaagggcagtatctgataccttgatgacaattaatcggatggagcaggcacgcacagaatacagaggagctctactgtggatgaaagatgtatcccaagagctggacccagacaccttaaagcaaatggaaaagtttagaaaagtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine and glycine-rich protein 2 - RAB22A, member RAS oncogene family - coiled-coil domain containing 85B - regulator of G-protein signaling 16 |