RAB22A-RAB22A, member RAS oncogene family Gene View larger

RAB22A-RAB22A, member RAS oncogene family Gene

PTXBC015710

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB22A-RAB22A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB22A-RAB22A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015710
Product type: DNA & cDNA
Ncbi symbol: RAB22A
Origin species: Human
Product name: RAB22A-RAB22A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015710
Gene id: 57403
Gene description: RAB22A, member RAS oncogene family
Synonyms: RAB22A, member RAS oncogene family; GTP-binding protein RAB22A; ras-related protein Rab-22A; rab-22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgagggagctcaaagtgtgtctgctcggggatacaggtgtaggtaaatcgagtattgtgtggcggtttgtggaagacagttttgatccaaacatcaacccaacaataggggcatcttttatgaccaagactgtccagtaccaaaatgagctacataaattcctaatctgggatacagctggacaagaacgatttcgtgccttagcaccaatgtactatcgagggtcggctgcagctataatcgtttatgatatcacaaaagaagagacattttcaacattaaagaattgggtgaaagagcttcgacagcatggcccacctaatattgtagttgccattgcaggaaataaatgtgatcttatcgatgtaagagaagtcatggagagagatgcaaaggactacgccgactctattcatgcaatttttgtagagaccagcgcaaaaaacgcgataaacataaatgaactctttatagaaattagtcgaagaattccatccactgacgccaacctgccatctggcggtaagggcttcaaactccgaagacagccttcagagccaaagcggagctgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 85B
- regulator of G-protein signaling 16
- farnesyltransferase, CAAX box, alpha
- lipoma HMGIC fusion partner-like 5

Buy RAB22A-RAB22A, member RAS oncogene family Gene now

Add to cart