Login to display prices
Login to display prices
RAB22A-RAB22A, member RAS oncogene family Gene View larger

RAB22A-RAB22A, member RAS oncogene family Gene

PTXBC015710

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB22A-RAB22A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB22A-RAB22A, member RAS oncogene family Gene

Proteogenix catalog: PTXBC015710
Ncbi symbol: RAB22A
Product name: RAB22A-RAB22A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015710
Gene id: 57403
Gene description: RAB22A, member RAS oncogene family
Synonyms: RAB22A, member RAS oncogene family; GTP-binding protein RAB22A; ras-related protein Rab-22A; rab-22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgagggagctcaaagtgtgtctgctcggggatacaggtgtaggtaaatcgagtattgtgtggcggtttgtggaagacagttttgatccaaacatcaacccaacaataggggcatcttttatgaccaagactgtccagtaccaaaatgagctacataaattcctaatctgggatacagctggacaagaacgatttcgtgccttagcaccaatgtactatcgagggtcggctgcagctataatcgtttatgatatcacaaaagaagagacattttcaacattaaagaattgggtgaaagagcttcgacagcatggcccacctaatattgtagttgccattgcaggaaataaatgtgatcttatcgatgtaagagaagtcatggagagagatgcaaaggactacgccgactctattcatgcaatttttgtagagaccagcgcaaaaaacgcgataaacataaatgaactctttatagaaattagtcgaagaattccatccactgacgccaacctgccatctggcggtaagggcttcaaactccgaagacagccttcagagccaaagcggagctgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice