FNTA-farnesyltransferase, CAAX box, alpha Gene View larger

FNTA-farnesyltransferase, CAAX box, alpha Gene

PTXBC037295

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FNTA-farnesyltransferase, CAAX box, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FNTA-farnesyltransferase, CAAX box, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037295
Product type: DNA & cDNA
Ncbi symbol: FNTA
Origin species: Human
Product name: FNTA-farnesyltransferase, CAAX box, alpha Gene
Size: 2ug
Accessions: BC037295
Gene id: 2339
Gene description: farnesyltransferase, CAAX box, alpha
Synonyms: FPTA; PGGT1A; PTAR2; protein farnesyltransferase/geranylgeranyltransferase type-1 subunit alpha; FTase-alpha; GGTase-I-alpha; farnesyl-protein transferase alpha-subunit; protein prenyltransferase alpha subunit repeat containing 2; ras proteins prenyltransferase subunit alpha; type I protein geranyl-geranyltransferase alpha subunit; farnesyltransferase, CAAX box, alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctgtacagttagagatgtttatgattacttccgagctgtcctgcagcgtgatgaaagaagtgaacgagcttttaagctaacccgggatgctattgagttaaatgcagccaattatacagtgtggcatttccggagagttcttttgaagtcacttcagaaggatctacatgaggaaatgaactacatcactgcaataattgaggagcagcccaaaaactatcaagtttggcatcataggcgagtattagtggaatggctaagagatccatctcaggagcttgaatttattgctgatattcttaatcaggatgcaaagaattatcatgcctggcagcatcgacaatgggttattcaggaatttaaactttgggataatgagctgcagtatgtggaccaacttctgaaagaggatgtgagaaataactctgtctggaaccaaagatacttcgttatttctaacaccactggctacaatgatcgtgctgtattggagagagaagtccagttagtaatctccttcacttgctcattcgttacaaacatgtttgcatgcctaccatatctcaggcactggggatacagcagatcaagatcctaccccatggaactaaaagaggacagagtactgagtggaacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lipoma HMGIC fusion partner-like 5
- Nedd4 family interacting protein 1
- zinc finger, C4H2 domain containing
- coiled-coil domain containing 134

Buy FNTA-farnesyltransferase, CAAX box, alpha Gene now

Add to cart