Login to display prices
Login to display prices
CCDC134-coiled-coil domain containing 134 Gene View larger

CCDC134-coiled-coil domain containing 134 Gene

PTXBC017693

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC134-coiled-coil domain containing 134 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC134-coiled-coil domain containing 134 Gene

Proteogenix catalog: PTXBC017693
Ncbi symbol: CCDC134
Product name: CCDC134-coiled-coil domain containing 134 Gene
Size: 2ug
Accessions: BC017693
Gene id: 79879
Gene description: coiled-coil domain containing 134
Synonyms: coiled-coil domain-containing protein 134; coiled-coil domain containing 134
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccttcttcaattcctggccttcctctttgtcctgcttttgtctgggatgggagccacaggcaccttgaggacctccctggacccaagcctggagatctacaagaagatgtttgaggtgaagcggcgggagcagctgttggcactgaagaacctggcacagctgaacgacatccaccagcagtacaagatccttgatgtcatgctcaaggggctctttaaggtgctggaggactcccggacagtgctcaccgctgctgatgtgctcccagatgggcccttcccccaggacgagaagctgaaggatgctttctcccacgtggtggagaacacggccttcttcggcgatgtggtgctgcgcttcccgaggattgtgcactattactttgaccacaactccaactggaacctcctcatccgctggggtatcagtttctgcaaccagacaggcgtcttcaaccaggggccccactcgcccatcctcagcctgatggcccaggagctggggatcagtgagaaagactccaacttccagaacccatttaaaatcgaccgcacagagttcattcccagcactgaccctttccagaaggccctgagagaagaagagaaacgccgaaagaaagaggagaagcggaaggagatccgaaaaggcccaaggatctccagatcccagtctgagttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: