NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene View larger

NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005202
Product type: DNA & cDNA
Ncbi symbol: NIPSNAP3B
Origin species: Human
Product name: NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene
Size: 2ug
Accessions: BC005202
Gene id: 55335
Gene description: nipsnap homolog 3B (C. elegans)
Synonyms: FP944; NIPSNAP3; SNAP1; protein NipSnap homolog 3B; nipsnap homolog 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcgttctcagaagcggcctgaccaaggcgcttgcctcacggacgctcgcgcctcaggtgtgttcatcttttgctacgggccctagacaatacgatggaacgttctatgaatttcgtacttattaccttaaaccttcaaatatgaatgcgttcatggaaaatcttaagaaaaacattcatcttcggacctcttactctgaattggttggattctggagtgtagaatttggaggcagaacgaataaagtgtttcatatttggaagtatgataattttgctcatcgagctgaagttcggaaagccttagccaactgtaaggaatggcaagaacaatctatcattccaaatttggctcgcattgataaacaagagacggaaattacttacctgataccatggtccaaattagaaaagcctccaaaagaaggagtctatgaactagctgtttttcagatgaaacctggtgggccagctctgtggggtgatgcatttgaaagagcaattaatgcccatgtcaatttaggctacacaaaagtagttggtgttttccacacagaatatggagaactcaacagagttcatgttctttggtggaatgagagtgcagatagtcgtgcagctgggagacataagtcccatgaggatcccagagttgtggcggctgttcgggaaagtgtcaactacctagtttctcagcagaatatgcttctgattcctgcatcattttcaccattgaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thyroid stimulating hormone receptor
- RAB3A interacting protein (rabin3)
- coiled-coil domain containing 148
- coiled-coil domain containing 127

Buy NIPSNAP3B-nipsnap homolog 3B (C. elegans) Gene now

Add to cart