TSHR-thyroid stimulating hormone receptor Gene View larger

TSHR-thyroid stimulating hormone receptor Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSHR-thyroid stimulating hormone receptor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSHR-thyroid stimulating hormone receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009237
Product type: DNA & cDNA
Ncbi symbol: TSHR
Origin species: Human
Product name: TSHR-thyroid stimulating hormone receptor Gene
Size: 2ug
Accessions: BC009237
Gene id: 7253
Gene description: thyroid stimulating hormone receptor
Synonyms: CHNG1; LGR3; hTSHR-I; TSH receptor; seven transmembrane helix receptor; thyrotropin receptor-I, hTSHR-I; thyroid stimulating hormone receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagcttattgagactcacctgagaactattccaagtcatgcattttctaatctgcccaatatttccagaatctacgtatctatagatgtgactctgcagcagctggaatcacactccttctacaatttgagtaaagtgactcacatagaaattcggaataccaggaacttaacttacatagaccctgatgccctcaaagagctccccctcctaaagttccttggcattttcaacactggacttaaaatgttccctgacctgaccaaagtttattccactgatatattctttatacttgaaattacagacaacccttacatgacgtcaatccctgtgaatgcttttcagggactatgcaatgaaaccttgacactgaagctgtacaacaatggctttacttcagtccaaggatatgctttcaatgggacaaagctggatgctgtttacctaaacaagaataaatacctgacagttattgacaaagatgcatttggaggagtatacagtggaccaagcttgctgctgcctcttggaagaaagtccttgtcctttgagactcagaaggccccaagctccagtatgccatcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB3A interacting protein (rabin3)
- coiled-coil domain containing 148
- coiled-coil domain containing 127
- RAB40B, member RAS oncogene family

Buy TSHR-thyroid stimulating hormone receptor Gene now

Add to cart