RAB3IP-RAB3A interacting protein (rabin3) Gene View larger

RAB3IP-RAB3A interacting protein (rabin3) Gene

PTXBC015548

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB3IP-RAB3A interacting protein (rabin3) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB3IP-RAB3A interacting protein (rabin3) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015548
Product type: DNA & cDNA
Ncbi symbol: RAB3IP
Origin species: Human
Product name: RAB3IP-RAB3A interacting protein (rabin3) Gene
Size: 2ug
Accessions: BC015548
Gene id: 117177
Gene description: RAB3A interacting protein (rabin3)
Synonyms: RABIN3; RABIN8; rab-3A-interacting protein; SSX2 interacting protein; rab3A-interacting protein; rabin-3; RAB3A interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagagaagcaaatatcaagcaggcaacagcagaaaaacagctaaaagaagcacaaggaaaaattgatgtacttcaagctgaagtagctgcattgaagacacttgtattgtccagttctccaacatcacctacgcaggagcctttgccaggtggaaagacaccttttaaaaaggggcatacaagaaataaaagcacaagcagtgctatgagtggcagtcatcaggacctcagtgtgatacagccaattgtaaaagactgcaaagaggctgacttatccttgtataatgaattccgattgtggaaggatgagcccacaatggacaggacgtgtcctttcttagacaaaatctaccaggaagatatctttccatgtttaacattctcaaaaagtgagttggcttcagctgttctggaggctgtggaaaacaatactctaagcattgaaccagtgggattacaacctatccggtttgtgaaagcttctgcagttgaatgcggaggaccaaaaaaatgtgctctcactggccagagtaagtcctgtaaacacagaattaaattaggggactcaagcaactattattatatttctcctttttgcagatacaggatcacttctgtatgtaacttttttacatacattcgatacattcagcagggactcgtgaaacagcaggatgttgatcagatgttttgggaggttatgcagttgagaaaagagatgtcattggcaaagctgggttatttcaaagaggaactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 148
- coiled-coil domain containing 127
- RAB40B, member RAS oncogene family
- coiled-coil domain containing 101

Buy RAB3IP-RAB3A interacting protein (rabin3) Gene now

Add to cart