CCDC101-coiled-coil domain containing 101 Gene View larger

CCDC101-coiled-coil domain containing 101 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC101-coiled-coil domain containing 101 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC101-coiled-coil domain containing 101 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011981
Product type: DNA & cDNA
Ncbi symbol: CCDC101
Origin species: Human
Product name: CCDC101-coiled-coil domain containing 101 Gene
Size: 2ug
Accessions: BC011981
Gene id: 112869
Gene description: coiled-coil domain containing 101
Synonyms: CCDC101; STAF36; TDRD29; SAGA-associated factor 29; SAGA-associated factor 29 homolog; coiled-coil domain containing 101; coiled-coil domain-containing protein 101; SAGA complex associated factor 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctcgtgtctgccgattcccgcattgcagaacttctcacagagctccatcagctgatcaaacaaacccaggaagagcgttcgcggagcgaacacaacttagtgaacatccagaagacccatgagcggatgcagacagagaacaagatttctccctattaccggacaaagctgcgtggcctctacacaaccgccaaggccgatgcagaggctgagtgcaacatccttcggaaagctctggacaagatcgcggaaatcaagtctctgttggaagagaggcggattgcggccaagattgccggtctctacaatgactcggagccaccccggaagaccatgcgcagaggggtgctgatgaccctgctgcagcagtcggccatgaccctgcccctgtggatcgggaagcctggtgacaagcccccacccctctgtggggccatccctgcctcaggagactacgtggccagacctggagacaaggtggctgcccgggtgaaggccgtggatggggacgagcagtggatcctggccgaggtggtcagttacagccatgccaccaacaagtatgaggtagatgacatcgatgaagaaggcaaagagagacacaccctgagccggcgccgtgtcatcccgctgccccagtggaaggccaacccggagacggaccctgaggccttgttccagaaggagcagctcgtgctggccctgtatccccagactacctgcttctaccgcgccctgatccatgcgcccccacagcggccccaggatgactactcggtcctgtttgaagacacctcctatgcagatggctattcccctcccctcaatgtggctcagagatacgtggtggcttgtaaggaacccaagaaaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secreted frizzled-related protein 2
- CPX chromosome region, candidate 1
- polycystic kidney disease 1-like 2
- carbonic anhydrase VB, mitochondrial

Buy CCDC101-coiled-coil domain containing 101 Gene now

Add to cart