Cart 1 Product Products 113,40 € (empty)
-
1 x GOSR2-golg...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of PKD1L2-polycystic kidney disease 1-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PKD1L2-polycystic kidney disease 1-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014157 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PKD1L2 |
| Origin species: | Human |
| Product name: | PKD1L2-polycystic kidney disease 1-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC014157 |
| Gene id: | 114780 |
| Gene description: | polycystic kidney disease 1-like 2 |
| Synonyms: | PC1L2; polycystic kidney disease protein 1-like 2; PC1-like 2 protein; polycystic kidney disease 1-like 2; polycystin-1L2; polycystin 1 like 2 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggaggactctccagtggctatgttcagctggtatttggacaacaccccaacagagcaggctgagcccctcccggatgcctgcagactcagaggattttggccaaggtccttaaccctcctccagagcaacacctccacgttgctgttgaacagctcgtttctgcagtcccggggagaggtcatccgaatcagagccacagcactgaccaggcatgcctatggggaggacacctatgtgatcagcactgtgcctccccgtgaggtgcctgcctgcactattgccccagaggagggcaccgttctgacgagctttgccatcttctgcaacgcctccacagccctgggacccctggagttctgcttctgtctggaatcaggttcctgcctacactgtggccctgaacctgccctcccatcagtgtatctgccacttggagaggagaacaatgactttgtgctgacagtagttatttctgccaccaatcgtgcaggggacacgcagcagacccaggccatggctaaggtggcactcggagacacatgtgttgaggatgtagcattccaggctgccgtgtcagagaaaatccccacagctctgcaaggcgagggtggccccgagcagctcctccagctggccaaggctgtgtcctccatgctgaaccaagagcatgaaagccagggctcaggacagtcactgagcatagacgtcagacagaaggtcagagagcatgtgctgggatcactgtctgcagtcaccaccggcttggaggacgtgcagagggtgcaggagctggccgaggtgctgagagaggtgacctgccggagtaaggaactcacaccctcggcccaggggtcctgcatgggcgattcatgggaaggtgcccctcctgctgcccatgtatctcacgctaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbonic anhydrase VB, mitochondrial - pyrroline-5-carboxylate reductase 1 - presenilin associated, rhomboid-like - coiled-coil domain containing 104 |