PKD1L2-polycystic kidney disease 1-like 2 Gene View larger

PKD1L2-polycystic kidney disease 1-like 2 Gene

PTXBC014157

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PKD1L2-polycystic kidney disease 1-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PKD1L2-polycystic kidney disease 1-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014157
Product type: DNA & cDNA
Ncbi symbol: PKD1L2
Origin species: Human
Product name: PKD1L2-polycystic kidney disease 1-like 2 Gene
Size: 2ug
Accessions: BC014157
Gene id: 114780
Gene description: polycystic kidney disease 1-like 2
Synonyms: PC1L2; polycystic kidney disease protein 1-like 2; PC1-like 2 protein; polycystic kidney disease 1-like 2; polycystin-1L2; polycystin 1 like 2 (gene/pseudogene)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggaggactctccagtggctatgttcagctggtatttggacaacaccccaacagagcaggctgagcccctcccggatgcctgcagactcagaggattttggccaaggtccttaaccctcctccagagcaacacctccacgttgctgttgaacagctcgtttctgcagtcccggggagaggtcatccgaatcagagccacagcactgaccaggcatgcctatggggaggacacctatgtgatcagcactgtgcctccccgtgaggtgcctgcctgcactattgccccagaggagggcaccgttctgacgagctttgccatcttctgcaacgcctccacagccctgggacccctggagttctgcttctgtctggaatcaggttcctgcctacactgtggccctgaacctgccctcccatcagtgtatctgccacttggagaggagaacaatgactttgtgctgacagtagttatttctgccaccaatcgtgcaggggacacgcagcagacccaggccatggctaaggtggcactcggagacacatgtgttgaggatgtagcattccaggctgccgtgtcagagaaaatccccacagctctgcaaggcgagggtggccccgagcagctcctccagctggccaaggctgtgtcctccatgctgaaccaagagcatgaaagccagggctcaggacagtcactgagcatagacgtcagacagaaggtcagagagcatgtgctgggatcactgtctgcagtcaccaccggcttggaggacgtgcagagggtgcaggagctggccgaggtgctgagagaggtgacctgccggagtaaggaactcacaccctcggcccaggggtcctgcatgggcgattcatgggaaggtgcccctcctgctgcccatgtatctcacgctaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase VB, mitochondrial
- pyrroline-5-carboxylate reductase 1
- presenilin associated, rhomboid-like
- coiled-coil domain containing 104

Buy PKD1L2-polycystic kidney disease 1-like 2 Gene now

Add to cart