Login to display prices
Login to display prices
RAB40B-RAB40B, member RAS oncogene family Gene View larger

RAB40B-RAB40B, member RAS oncogene family Gene

PTXBC018039

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB40B-RAB40B, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB40B-RAB40B, member RAS oncogene family Gene

Proteogenix catalog: PTXBC018039
Ncbi symbol: RAB40B
Product name: RAB40B-RAB40B, member RAS oncogene family Gene
Size: 2ug
Accessions: BC018039
Gene id: 10966
Gene description: RAB40B, member RAS oncogene family
Synonyms: RAB40B, member RAS oncogene family; RAR; SEC4L; ras-related protein Rab-40B; GTP-binding protein homologous to Saccharomyces cerevisiae SEC4; SOCS box-containing protein RAR; protein Rar
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgccctgggcagcccggtccgggcctacgactttctgctcaagttcctgctggtgggcgacagcgacgtgggcaagggcgagatcctggcgagcctgcaggatggcgcggccgagtccacgtacggccacccggcgggcatcgactacaagacgaccaccatcctgctggacgggcggcgggtgaagctgcagctctgggatacttcaggccagggaagattttgtaccatattccgctcctactcccggggcgcacagggtgtgatcctggtctatgacattgcgaaccgctggtcttttgacggcattgatcgatggattaaggagatcgatgagcatgcccccggagtccccaagatcctggtggggaaccgcctgcacctggcgttcaagcggcaggtgcccacggagcaggcccaggcctacgccgagcgcctgggcgtgaccttctttgaggtcagccctctgtgcaatttcaacatcacagagtcgttcacggagctggccaggatcgtgctgctgcggcatgggatggaccggctctggcggccgagcaaggtgctgagcttgcaagacctctgctgccgggcggtcgtgtcctgcacgccggtgcacctggtggacaagctcccgctccccattgccttaagaagccacctcaagtccttctcgatggccaacggcctgaatgccaggatgatgcacggcggttcctactccctcaccaccagctccacccacaaaaggagcagcctccgcaaagtgaagctcgtccgccccccccagagcccccccaaaaactgcaccagaaacagctgcaaaatttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: