CCDC127-coiled-coil domain containing 127 Gene View larger

CCDC127-coiled-coil domain containing 127 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC127-coiled-coil domain containing 127 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC127-coiled-coil domain containing 127 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015349
Product type: DNA & cDNA
Ncbi symbol: CCDC127
Origin species: Human
Product name: CCDC127-coiled-coil domain containing 127 Gene
Size: 2ug
Accessions: BC015349
Gene id: 133957
Gene description: coiled-coil domain containing 127
Synonyms: coiled-coil domain-containing protein 127; coiled-coil domain containing 127
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaataacctaaatgatcccccaaattggaatatccggcctaattccagggcggatggtggtgatggaagcaggtggaattatgccctgttggttccaatgctgggattggctgcttttcgttggatttggtctagggagtcccagaaagaagtagaaaaagagagagaagcctaccgtcggagaactgctgcttttcaacaggatctggaagccaagtaccacgccatgatctcagaaaatcggcgtgctgtcgctcagttgtccttggaactcgaaaaggaacaaaacagaactgctagttaccgagaagcccttatctctcagggacgcaagttggtagaagaaaagaagcttctggaacaggaacgggcccaggtgatgcaagaaaaaagacaggtgcagcctttgagaagtgcgtatttgagctgcctgcaaagggaagaaaactggcaaaggagagccaggcttttgctgaaagaatttgaagctgttctcacagaaagacagaatatctactgcagtctgtttcttcctcgcagcaagcggctggagatagagaagagcttactggtgcgagcgtccgtcgaccccgtcgccgctgacctagagatggcagccggtctcaccgacatatttcagcatgatacatactgtggtgatgtctggaacaccaacaaacgccagaatggcagactcatgtggctctatctcaaatactgggaactcgttgtcgaactgaagaagtttaagagagtagaggaagccatactagaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB40B, member RAS oncogene family
- coiled-coil domain containing 101
- secreted frizzled-related protein 2
- CPX chromosome region, candidate 1

Buy CCDC127-coiled-coil domain containing 127 Gene now

Add to cart