LHFPL5-lipoma HMGIC fusion partner-like 5 Gene View larger

LHFPL5-lipoma HMGIC fusion partner-like 5 Gene

PTXBC028630

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LHFPL5-lipoma HMGIC fusion partner-like 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LHFPL5-lipoma HMGIC fusion partner-like 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028630
Product type: DNA & cDNA
Ncbi symbol: LHFPL5
Origin species: Human
Product name: LHFPL5-lipoma HMGIC fusion partner-like 5 Gene
Size: 2ug
Accessions: BC028630
Gene id: 222662
Gene description: lipoma HMGIC fusion partner-like 5
Synonyms: DFNB67; dJ510O8.8; tetraspan membrane protein of hair cell stereocilia; LHFP-like protein 5; lipoma HMGIC fusion partner-like 5 protein; lipoma HMGIC fusion partner-like 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaaattgctgccggcccaggaggcagccaagatctaccataccaactatgtgcggaactcgcgagccgtgggcgtgatgtggggtaccctcaccatctgcttctccgtactggtcatggccctcttcatccagccctactggatcggcgacagcgtcaacacaccgcaggcaggctacttcggccttttctcctactgcgtgggtaacgtgctgtcctccgagctcatctgcaagggcggccccctagacttctcctccatcccctctagagccttcaagactgccatgttctttgtggccttgggcatgttcctcatcattggctccatcatctgcttcagcctgttcttcatctgcaacacggccacagtctataagatctgtgcatggatgcagctggctgcggccacaggcctaatgattggctgcctggtctaccctgatggttgggactcaagtgaggtgcggcgcatgtgtggggagcagacgggcaagtacacgctgggccactgcaccatccgctgggccttcatgctggccatcctcagcattggcgacgccctcatcctctccttcctggccttcgtgttgggctaccggcaggacaagctcctccctgacgactacaaggcagatggaacagaggaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Nedd4 family interacting protein 1
- zinc finger, C4H2 domain containing
- coiled-coil domain containing 134
- isochorismatase domain containing 1

Buy LHFPL5-lipoma HMGIC fusion partner-like 5 Gene now

Add to cart