CCDC85B-coiled-coil domain containing 85B Gene View larger

CCDC85B-coiled-coil domain containing 85B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC85B-coiled-coil domain containing 85B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC85B-coiled-coil domain containing 85B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008796
Product type: DNA & cDNA
Ncbi symbol: CCDC85B
Origin species: Human
Product name: CCDC85B-coiled-coil domain containing 85B Gene
Size: 2ug
Accessions: BC008796
Gene id: 11007
Gene description: coiled-coil domain containing 85B
Synonyms: DIPA; coiled-coil domain-containing protein 85B; delta-interacting protein A; hepatitis delta antigen-interacting protein A; coiled-coil domain containing 85B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgaggcaggcggcctggaggagctgacggacgaggagatggcggcgctaggcaaggaagagctagtgcggcgcctgcggcgggaggaggcggcgcgcctggcggcactggtgcagcgcggccgcctcatgcaggaggtgaatcggcagctgcagggccacctgggcgagatccgcgagctcaagcagctcaaccggcgtctgcaggcagagaaccgtgagctgcgcgacctctgctgcttcctggactcggagcgccagcgcgggcggcgcgccgcacgccagtggcagctcttcgggacccaagcatcccgggccgtgcgcgaggacctgggcggctgttggcagaagctggccgagctggagggccgccaggaggagctgctgcgggagaacctagcgcttaaggagctctgcctggcgctgggcgaagaatggggcccccgcggcggccccagcggcgccgggggatcaggagccgggccagcacccgagcttgccttgcccccgtgcgggccccgcgacctaggcgatggaagctccagcactggcagcgtgggcagtccggatcagttgcccctggcctgttcccccgatgattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of G-protein signaling 16
- farnesyltransferase, CAAX box, alpha
- lipoma HMGIC fusion partner-like 5
- Nedd4 family interacting protein 1

Buy CCDC85B-coiled-coil domain containing 85B Gene now

Add to cart