PTXBC000992
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000992 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CSRP2 |
| Origin species: | Human |
| Product name: | CSRP2-cysteine and glycine-rich protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC000992 |
| Gene id: | 1466 |
| Gene description: | cysteine and glycine-rich protein 2 |
| Synonyms: | CRP2; LMO5; SmLIM; cysteine and glycine-rich protein 2; LIM domain only 5, smooth muscle; LIM domain only protein 5; LMO-5; cysteine-rich protein 2; smooth muscle cell LIM protein; cysteine and glycine rich protein 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgtctggggaggtggaaacaagtgtggggcctgtgggaggaccgtgtaccacgcagaagaggtgcagtgtgatggcaggagcttccaccgctgctgctttctctgcatggtttgcaggaaaaatttagatagcacaacagtggcaattcacgatgaagagatctactgcaaatcctgctacggaaagaagtatgggccaaaaggctacggttatggccagggcgctggcacgcttaacatggaccgtggcgagaggctgggcatcaaaccagagagtgttcagcctcacaggcctacaacaaatccaaacacttctaaatttgctcagaaatatggaggtgctgagaagtgttccagatgtggggattctgtatatgctgccgagaagataattggagctggaaagccctggcacaaaaactgtttccgatgtgcaaagtgtgggaagagtcttgaatcaacaactctgactgaaaaagaaggtgaaatctattgtaaaggatgctatgcaaagaactttgggcccaagggatttggctatggccaaggagcaggggctcttgttcatgcccagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - RAB22A, member RAS oncogene family - coiled-coil domain containing 85B - regulator of G-protein signaling 16 - farnesyltransferase, CAAX box, alpha |