CSRP2-cysteine and glycine-rich protein 2 Gene View larger

CSRP2-cysteine and glycine-rich protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSRP2-cysteine and glycine-rich protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSRP2-cysteine and glycine-rich protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000992
Product type: DNA & cDNA
Ncbi symbol: CSRP2
Origin species: Human
Product name: CSRP2-cysteine and glycine-rich protein 2 Gene
Size: 2ug
Accessions: BC000992
Gene id: 1466
Gene description: cysteine and glycine-rich protein 2
Synonyms: CRP2; LMO5; SmLIM; cysteine and glycine-rich protein 2; LIM domain only 5, smooth muscle; LIM domain only protein 5; LMO-5; cysteine-rich protein 2; smooth muscle cell LIM protein; cysteine and glycine rich protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgtctggggaggtggaaacaagtgtggggcctgtgggaggaccgtgtaccacgcagaagaggtgcagtgtgatggcaggagcttccaccgctgctgctttctctgcatggtttgcaggaaaaatttagatagcacaacagtggcaattcacgatgaagagatctactgcaaatcctgctacggaaagaagtatgggccaaaaggctacggttatggccagggcgctggcacgcttaacatggaccgtggcgagaggctgggcatcaaaccagagagtgttcagcctcacaggcctacaacaaatccaaacacttctaaatttgctcagaaatatggaggtgctgagaagtgttccagatgtggggattctgtatatgctgccgagaagataattggagctggaaagccctggcacaaaaactgtttccgatgtgcaaagtgtgggaagagtcttgaatcaacaactctgactgaaaaagaaggtgaaatctattgtaaaggatgctatgcaaagaactttgggcccaagggatttggctatggccaaggagcaggggctcttgttcatgcccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB22A, member RAS oncogene family
- coiled-coil domain containing 85B
- regulator of G-protein signaling 16
- farnesyltransferase, CAAX box, alpha

Buy CSRP2-cysteine and glycine-rich protein 2 Gene now

Add to cart