RGS10-regulator of G-protein signaling 10 Gene View larger

RGS10-regulator of G-protein signaling 10 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS10-regulator of G-protein signaling 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RGS10-regulator of G-protein signaling 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009361
Product type: DNA & cDNA
Ncbi symbol: RGS10
Origin species: Human
Product name: RGS10-regulator of G-protein signaling 10 Gene
Size: 2ug
Accessions: BC009361
Gene id: 6001
Gene description: regulator of G-protein signaling 10
Synonyms: regulator of G-protein signaling 10; regulator of G-protein signalling 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaaccgcgccgtgagccggctgagcaggaagcggccgccgtcagacatccacgacagcgatggcagttccagcagcagccaccagagcctcaagagcacagccaaatgggcggcatccctggagaatctgctggaagacccagaaggcgtgaaaagatttagggaatttttaaaaaaggaattcagtgaagaaaatgttttgttttggctagcatgtgaagattttaagaaaatgcaagataagacgcagatgcaggaaaaggcaaaggagatctacatgacctttctgtccagcaaggcctcatcacaggtcaacgtggaggggcagtctcggctcaacgagaagatcctggaagaaccgcaccctctgatgttccagaaactccaggaccagatctttaatctcatgaagtacgacagctacagccgcttcttaaagtctgacttgtttttaaaacacaagcgaaccgaggaagaggaagaagatttgcctgatgctcaaactgcagctaaaagagcttccagaatttataacacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microfibrillar-associated protein 2
- islet cell autoantigen 1,69kDa-like
- cysteine and glycine-rich protein 2
- RAB22A, member RAS oncogene family

Buy RGS10-regulator of G-protein signaling 10 Gene now

Add to cart