Login to display prices
Login to display prices
RGS10-regulator of G-protein signaling 10 Gene View larger

RGS10-regulator of G-protein signaling 10 Gene

PTXBC009361

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS10-regulator of G-protein signaling 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS10-regulator of G-protein signaling 10 Gene

Proteogenix catalog: PTXBC009361
Ncbi symbol: RGS10
Product name: RGS10-regulator of G-protein signaling 10 Gene
Size: 2ug
Accessions: BC009361
Gene id: 6001
Gene description: regulator of G-protein signaling 10
Synonyms: regulator of G-protein signaling 10; regulator of G-protein signalling 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaaccgcgccgtgagccggctgagcaggaagcggccgccgtcagacatccacgacagcgatggcagttccagcagcagccaccagagcctcaagagcacagccaaatgggcggcatccctggagaatctgctggaagacccagaaggcgtgaaaagatttagggaatttttaaaaaaggaattcagtgaagaaaatgttttgttttggctagcatgtgaagattttaagaaaatgcaagataagacgcagatgcaggaaaaggcaaaggagatctacatgacctttctgtccagcaaggcctcatcacaggtcaacgtggaggggcagtctcggctcaacgagaagatcctggaagaaccgcaccctctgatgttccagaaactccaggaccagatctttaatctcatgaagtacgacagctacagccgcttcttaaagtctgacttgtttttaaaacacaagcgaaccgaggaagaggaagaagatttgcctgatgctcaaactgcagctaaaagagcttccagaatttataacacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice