Cart 2 Product Products 234,90 € (empty)
-
1 x B3GNT2-UDP...121,50 € -
1 x MXI1-MAX...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of MFAP2-microfibrillar-associated protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MFAP2-microfibrillar-associated protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015039 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MFAP2 |
| Origin species: | Human |
| Product name: | MFAP2-microfibrillar-associated protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC015039 |
| Gene id: | 4237 |
| Gene description: | microfibrillar-associated protein 2 |
| Synonyms: | MAGP; MAGP-1; MAGP1; microfibrillar-associated protein 2; microfibril-associated glycoprotein 1; microfibrillar associated protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagctgcctacctcttcctgctattcctgcctgcaggcttgctggctcagggccagtatgacctggacccgctgccgccgttccctgaccacgtccagtacacccactatagcgaccagatcgacaacccagactactatgattatcaagaggtgactcctcggccctccgaggaacagttccagttccagtcccagcagcaagtccaacaggaagtcatcccagccccaaccccagaaccaggaaatgcagagctggagcccacagagcctgggcctcttgactgccgtgaggaacagtacccgtgcacccgcctctactccatacacaggccttgcaaacagtgtctcaacgaggtctgcttctacagcctccgccgtgtgtacgtcattaacaaggagatctgtgttcgtacagtgtgtgcccacgaggagctcctccgagctgacctctgtcgggacaagttctccaaatgtggcgtgatggccagcagcggcctgtgccaatccgtggcggcctcctgtgccaggagctgtgggagctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - islet cell autoantigen 1,69kDa-like - cysteine and glycine-rich protein 2 - RAB22A, member RAS oncogene family - coiled-coil domain containing 85B |