MFAP2-microfibrillar-associated protein 2 Gene View larger

MFAP2-microfibrillar-associated protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MFAP2-microfibrillar-associated protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MFAP2-microfibrillar-associated protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015039
Product type: DNA & cDNA
Ncbi symbol: MFAP2
Origin species: Human
Product name: MFAP2-microfibrillar-associated protein 2 Gene
Size: 2ug
Accessions: BC015039
Gene id: 4237
Gene description: microfibrillar-associated protein 2
Synonyms: MAGP; MAGP-1; MAGP1; microfibrillar-associated protein 2; microfibril-associated glycoprotein 1; microfibrillar associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagctgcctacctcttcctgctattcctgcctgcaggcttgctggctcagggccagtatgacctggacccgctgccgccgttccctgaccacgtccagtacacccactatagcgaccagatcgacaacccagactactatgattatcaagaggtgactcctcggccctccgaggaacagttccagttccagtcccagcagcaagtccaacaggaagtcatcccagccccaaccccagaaccaggaaatgcagagctggagcccacagagcctgggcctcttgactgccgtgaggaacagtacccgtgcacccgcctctactccatacacaggccttgcaaacagtgtctcaacgaggtctgcttctacagcctccgccgtgtgtacgtcattaacaaggagatctgtgttcgtacagtgtgtgcccacgaggagctcctccgagctgacctctgtcgggacaagttctccaaatgtggcgtgatggccagcagcggcctgtgccaatccgtggcggcctcctgtgccaggagctgtgggagctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - islet cell autoantigen 1,69kDa-like
- cysteine and glycine-rich protein 2
- RAB22A, member RAS oncogene family
- coiled-coil domain containing 85B

Buy MFAP2-microfibrillar-associated protein 2 Gene now

Add to cart