MRCL3-myosin regulatory light chain MRCL3 Gene View larger

MRCL3-myosin regulatory light chain MRCL3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRCL3-myosin regulatory light chain MRCL3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRCL3-myosin regulatory light chain MRCL3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031972
Product type: DNA & cDNA
Ncbi symbol: MRCL3
Origin species: Human
Product name: MRCL3-myosin regulatory light chain MRCL3 Gene
Size: 2ug
Accessions: BC031972
Gene id: 10627
Gene description: myosin regulatory light chain MRCL3
Synonyms: MRCL3; HEL-S-24; MLC-2B; MLCB; MRLC3; MYL2B; myosin regulatory light chain 12A; epididymis secretory protein Li 24; myosin RLC; myosin regulatory light chain 2, nonsarcomeric; myosin regulatory light chain 3; myosin regulatory light chain MRLC3; myosin, light chain 12A, regulatory, non-sarcomeric; myosin, light polypeptide, regulatory, non-sarcomeric (20kD); myosin light chain 12A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgagcaaaagaacaaagaccaagaccaagaagcgccctcagcgtgcaacatccaatgtgtttgctatgtttgaccagtcgcagattcaggagttcaaagaggccttcaacatgattgatcagaacagagatggtttcatcgacaaggaagatttgcatgatatgcttgcttcattggggaagaatccaactgatgagtatctagatgccatgatgaatgaggctccaggccccatcaatttcaccatgttcctcaccatgtttggtgagaagttaaatggcacagatcctgaagatgtcatcagaaatgcctttgcttgctttgatgaagaagcaactggcaccatacaggaagattacttgagagagctgctgacaaccatgggggatcggtttacagatgaggaagtggatgagctgtacagagaagcacctattgataaaaaggggaatttcaattacatcgagttcacacgcatcctgaaacatggagccaaagacaaagatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyrroline-5-carboxylate reductase 1
- myosin regulatory light chain MRCL3
- regulator of G-protein signaling 10
- microfibrillar-associated protein 2

Buy MRCL3-myosin regulatory light chain MRCL3 Gene now

Add to cart