Login to display prices
Login to display prices
RAB39B-RAB39B, member RAS oncogene family Gene View larger

RAB39B-RAB39B, member RAS oncogene family Gene

PTXBC009714

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB39B-RAB39B, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB39B-RAB39B, member RAS oncogene family Gene

Proteogenix catalog: PTXBC009714
Ncbi symbol: RAB39B
Product name: RAB39B-RAB39B, member RAS oncogene family Gene
Size: 2ug
Accessions: BC009714
Gene id: 116442
Gene description: RAB39B, member RAS oncogene family
Synonyms: RAB39B, member RAS oncogene family; MRX72; WSMN; ras-related protein Rab-39B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccatctggctgtaccagttccggctcattgtcatcggggattccacagtgggcaagtcctgcctgatccgccgcttcaccgagggtcgctttgcccaggtttctgaccccaccgtgggggtggattttttctcccgcttggtggagatcgagccaggaaaacgcatcaagctccagatctgggataccgcgggtcaagagaggttcagatccatcactcgcgcctactacaggaactcagtaggtggtcttctcttatttgacattaccaaccgcaggtccttccagaatgtccatgagtggttagaagagaccaaagtacacgttcagccctaccaaattgtatttgttctggtgggtcacaagtgtgacctggatacacagaggcaagtgactcgccacgaggccgagaaactggctgctgcatacggcatgaagtacattgaaacgtcagcccgagatgccattaatgtggagaaagccttcacagacctgacaagagacatatatgagctggttaaaaggggggagattacaatccaggagggctgggaaggggtgaagagtggatttgtaccaaatgtggttcactcttcagaagaggttgtcaaatcagagaggagatgtttgtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: