DRAM-damage-regulated autophagy modulator Gene View larger

DRAM-damage-regulated autophagy modulator Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DRAM-damage-regulated autophagy modulator Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DRAM-damage-regulated autophagy modulator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018435
Product type: DNA & cDNA
Ncbi symbol: DRAM
Origin species: Human
Product name: DRAM-damage-regulated autophagy modulator Gene
Size: 2ug
Accessions: BC018435
Gene id: 55332
Gene description: damage-regulated autophagy modulator
Synonyms: DRAM; DNA damage-regulated autophagy modulator protein 1; damage-regulated autophagy modulator; DNA damage regulated autophagy modulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtgcttcctgaggggaatggctttcgtccccttcctcttggtgacctggtcgtcagccgccttcattatctcctacgtggtcgccgtgctctccgggcacgtcaaccccttcctcccgtatatcagtgatacgggaacaacacctccagagagtggtatttttggatttatgataaacttctctgcatttcttggtgcagccacgatgtatacaagatacaaaatagtacagaagcaaaatcaaacctgctatttcagcactcctgtttttaacttggtgtctttagtgcttggattggtgggatgtttcggaatgggcattgtcgccaattttcaggagttagctgtgccagtggttcatgacgggggcgctcttttggcctttgtctgtggtgtcgtgtacacgctcctacagtccatcatctcttacaaatcatgtccccagtggaacagtctctcgacatgccacatacggatggtcatctctgccgtttcttgcgcagctgtcatccccatgattgtctgtgcttcactaatttccataaccaagctggagtggaatccaagagaaaaggattatgtatatcacgtagtgagtgcgatctgtgaatggacagtggcctttggttttattttctacttcctaactttcatccaagatttccagagtgtcaccctaaggatatccacagaaatcaatggtgatatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acetyl-Coenzyme A acyltransferase 1
- paroxysmal nonkinesigenic dyskinesia
- presenilin associated, rhomboid-like
- transcobalamin II; macrocytic anemia

Buy DRAM-damage-regulated autophagy modulator Gene now

Add to cart