Login to display prices
Login to display prices
ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene View larger

ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene

PTXBC014474

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene

Proteogenix catalog: PTXBC014474
Ncbi symbol: ACAA1
Product name: ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene
Size: 2ug
Accessions: BC014474
Gene id: 30
Gene description: acetyl-Coenzyme A acyltransferase 1
Synonyms: ACAA; PTHIO; THIO; 3-ketoacyl-CoA thiolase, peroxisomal; acetyl-Coenzyme A acyltransferase 1; beta-ketothiolase; peroxisomal 3-oxoacyl-CoA thiolase; peroxisomal 3-oxoacyl-Coenzyme A thiolase; testicular tissue protein Li 197; acetyl-CoA acyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaggctgcaggtagtgctgggccacctgaggggtccggccgattccggctggatgccgcaggccgcgccttgcctgagcggtgccccgcaggcctcggccgcggacgtggtggtggtgcacgggcggcgcacggccatctgccgggcgggccgcggcggcttcaaggacaccacccccgacgagcttctctcggcagtcatgaccgcggttctcaaggacgtgaatctgaggccggaacagctgggggacatctgtgtcggaaatgtgctgcagcctggggccggggcaatcatggcccgaatcgcccagtttctgagtgacatcccggagactgtgcctttgtccactgtcaatagacagtgttcgtcggggctacaggcagtggccagcatagcaggtggcatcagaaatgggtcttatgacattggcatggcctgtgggataacctctgagaatgtggctgagcggtttggcatttcacgggagaagcaggatacctttgccctggcttcccagcagaaggcagcaagagcccagagcaagggctgtttccaagctgagattgtgcctgtgaccaccacggtccatgatgacaagggcaccaagaggagcatcactgtgacccaggatgagggtatccgccccagcaccaccatggagggcctggccaaactgaagcctgccttcaagaaagatggttctaccacagctgggctgacagtgagtgacgtggacatcttcgagatcaatgaggcctttgcaagccaggctgcctactgtgtggagaagctacgactcccccctgagaaggtgaaccccctggggggtgcagtggccttagggcacccactgggctgcactggggcacgacaggccatcacgctgctcaatgagctgaagcgccgtgggaagagggcatacggagtggtgtccatgtgcatcgggactggaatgggagccgctgccgtctttgaataccctgggaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: