Cart 10 Product Products 4 864,01 € (empty)
No products
To be determined Shipping
4 864,01 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 864,01 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 864,01 €
Data sheet of ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014474 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACAA1 |
| Origin species: | Human |
| Product name: | ACAA1-acetyl-Coenzyme A acyltransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC014474 |
| Gene id: | 30 |
| Gene description: | acetyl-Coenzyme A acyltransferase 1 |
| Synonyms: | ACAA; PTHIO; THIO; 3-ketoacyl-CoA thiolase, peroxisomal; acetyl-Coenzyme A acyltransferase 1; beta-ketothiolase; peroxisomal 3-oxoacyl-CoA thiolase; peroxisomal 3-oxoacyl-Coenzyme A thiolase; testicular tissue protein Li 197; acetyl-CoA acyltransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaggctgcaggtagtgctgggccacctgaggggtccggccgattccggctggatgccgcaggccgcgccttgcctgagcggtgccccgcaggcctcggccgcggacgtggtggtggtgcacgggcggcgcacggccatctgccgggcgggccgcggcggcttcaaggacaccacccccgacgagcttctctcggcagtcatgaccgcggttctcaaggacgtgaatctgaggccggaacagctgggggacatctgtgtcggaaatgtgctgcagcctggggccggggcaatcatggcccgaatcgcccagtttctgagtgacatcccggagactgtgcctttgtccactgtcaatagacagtgttcgtcggggctacaggcagtggccagcatagcaggtggcatcagaaatgggtcttatgacattggcatggcctgtgggataacctctgagaatgtggctgagcggtttggcatttcacgggagaagcaggatacctttgccctggcttcccagcagaaggcagcaagagcccagagcaagggctgtttccaagctgagattgtgcctgtgaccaccacggtccatgatgacaagggcaccaagaggagcatcactgtgacccaggatgagggtatccgccccagcaccaccatggagggcctggccaaactgaagcctgccttcaagaaagatggttctaccacagctgggctgacagtgagtgacgtggacatcttcgagatcaatgaggcctttgcaagccaggctgcctactgtgtggagaagctacgactcccccctgagaaggtgaaccccctggggggtgcagtggccttagggcacccactgggctgcactggggcacgacaggccatcacgctgctcaatgagctgaagcgccgtgggaagagggcatacggagtggtgtccatgtgcatcgggactggaatgggagccgctgccgtctttgaataccctgggaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - paroxysmal nonkinesigenic dyskinesia - presenilin associated, rhomboid-like - transcobalamin II; macrocytic anemia - primase, DNA, polypeptide 1 (49kDa) |