ING5-inhibitor of growth family, member 5 Gene View larger

ING5-inhibitor of growth family, member 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ING5-inhibitor of growth family, member 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ING5-inhibitor of growth family, member 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005370
Product type: DNA & cDNA
Ncbi symbol: ING5
Origin species: Human
Product name: ING5-inhibitor of growth family, member 5 Gene
Size: 2ug
Accessions: BC005370
Gene id: 84289
Gene description: inhibitor of growth family, member 5
Synonyms: inhibitor of growth protein 5; inhibitor of growth family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccagaccagcgcgtggagcgcctgcagaagatccagaacgcctacagcaagtgcaaggaatacagtgacgacaaagtgcagctggccatgcagacctacgagatggtggataaacacattcgaaggcttgatgcagacctggcgcgctttgaagcagatctgaaggacaagatggagggcagtgattttgaaagctccggagggcgagggttaaaaaaaggccggggtcagaaagaaaaaagagggtcccggggccgaggcaggaggacatcagaggaagacacaccaaagaaaaagaagcacaaaggagggtctgagttcactgacaccatcctgtccgtgcacccctctgatgtgctggacatgcccgtggacccaaacgaacccacgtactgcctgtgccaccaggtctcctatggggagatgattggctgtgacaatccagactgtccaattgagtggtttcactttgcctgcgtggaccttaccacgaaacccaaaggaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - damage-regulated autophagy modulator
- acetyl-Coenzyme A acyltransferase 1
- paroxysmal nonkinesigenic dyskinesia
- presenilin associated, rhomboid-like

Buy ING5-inhibitor of growth family, member 5 Gene now

Add to cart