Login to display prices
Login to display prices
ING5-inhibitor of growth family, member 5 Gene View larger

ING5-inhibitor of growth family, member 5 Gene

PTXBC005370

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ING5-inhibitor of growth family, member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ING5-inhibitor of growth family, member 5 Gene

Proteogenix catalog: PTXBC005370
Ncbi symbol: ING5
Product name: ING5-inhibitor of growth family, member 5 Gene
Size: 2ug
Accessions: BC005370
Gene id: 84289
Gene description: inhibitor of growth family, member 5
Synonyms: inhibitor of growth protein 5; inhibitor of growth family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccagaccagcgcgtggagcgcctgcagaagatccagaacgcctacagcaagtgcaaggaatacagtgacgacaaagtgcagctggccatgcagacctacgagatggtggataaacacattcgaaggcttgatgcagacctggcgcgctttgaagcagatctgaaggacaagatggagggcagtgattttgaaagctccggagggcgagggttaaaaaaaggccggggtcagaaagaaaaaagagggtcccggggccgaggcaggaggacatcagaggaagacacaccaaagaaaaagaagcacaaaggagggtctgagttcactgacaccatcctgtccgtgcacccctctgatgtgctggacatgcccgtggacccaaacgaacccacgtactgcctgtgccaccaggtctcctatggggagatgattggctgtgacaatccagactgtccaattgagtggtttcactttgcctgcgtggaccttaccacgaaacccaaaggaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: