RAB11A-RAB11A, member RAS oncogene family Gene View larger

RAB11A-RAB11A, member RAS oncogene family Gene

PTXBC013348

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB11A-RAB11A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB11A-RAB11A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013348
Product type: DNA & cDNA
Ncbi symbol: RAB11A
Origin species: Human
Product name: RAB11A-RAB11A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC013348
Gene id: 8766
Gene description: RAB11A, member RAS oncogene family
Synonyms: RAB11A, member RAS oncogene family; YL8; ras-related protein Rab-11A; RAB 11A, member oncogene family; rab-11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcacccgcgacgacgagtacgactacctctttaaagttgtccttattggagattctggtgttggaaagagtaatctcctgtctcgatttactcgaaatgagtttaatctggaaagcaagagcaccattggagtagagtttgcaacaagaagcatccaggttgatggaaaaacaataaaggcacagatatgggacacagcagggcaagagcgatatcgagctataacatcagcatattatcgtggagctgtaggtgccttattggtttatgacattgctaaacatctcacatatgaaaatgtagagcgatggctgaaagaactgagagatcatgctgatagtaacattgttatcatgcttgtgggcaataagagtgatctacgtcatctcagggcagttcctacagatgaagcaagagcttttgcagaaaagaatggtttgtcattcattgaaacttcggccctagactctacaaatgtagaagctgcttttcagacaattttaacagagatttaccgcattgtttctcagaagcaaatgtcagacagacgcgaaaatgacatgtctccaagcaacaatgtggttcctattcatgttccaccaaccactgaaaacaagccaaaggtgcagtgctgtcagaacatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - D-2-hydroxyglutarate dehydrogenase
- inhibitor of growth family, member 5
- damage-regulated autophagy modulator
- acetyl-Coenzyme A acyltransferase 1

Buy RAB11A-RAB11A, member RAS oncogene family Gene now

Add to cart