SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene View larger

SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene

PTXBC009368

New product

Data sheet of SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009368
Product type: DNA & cDNA
Ncbi symbol: SMARCD1
Origin species: Human
Product name: SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene
Size: 2ug
Accessions: BC009368
Gene id: 6602
Gene description: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Synonyms: BAF60A; CRACD1; Rsc6p; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1; 60 kDa BRG-1/Brm-associated factor subunit A; BRG1-associated factor 60A; SWI/SNF complex 60 kDa subunit A; Swp73-like protein; chromatin remodeling complex BAF60A subunit; mammalian chromatin remodeling complex BRG1-associated factor 60A; SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcccgggcgggtttccagtctgtggctccaagcggcggcgccggagcctcaggaggggcgggcgcggctgctgccttgggcccgggcggaactccggggcctcctgtgcgaatgggcccggctccgggtcaagggctgtaccgctccccgatgcccggagcggcctatccgagaccaggtatgttgccaggcagccgaatgacacctcagggaccttccatgggaccccctggctatggggggaacccttcagtccgacctggcctggcccagtcagggatggatcagtcccgcaagagacctgcccctcagcagatccagcaggtccagcagcaggcggtccaaaatcgaaaccacaatgcaaagaaaaagaagatggctgacaaaattctacctcaaaggattcgtgaactggtaccagaatcccaggcctatatggatctcttggcttttgaaaggaaactggaccagactatcatgaggaaacggctagatatccaagaggccttgaaacgtcccatcaagcaaaaacggaagctgcgaattttcatttctaacactttcaatccggctaagtcagatgccgaggatggggaagggacggtggcttcctgggagcttcgggtagaaggacggctcctggaggattcagccttgtccaaatatgatgccactaaacaaaagaggaagttctcttccttttttaagtccttggtgattgaactggacaaagacctgtatgggccagacaaccatctggtagaatggcacaggaccgccactacccaggagaccgatggctttcaggtgaagcggccgggagacgtgaatgtacggtgtactgtcctactgatgctggattaccagcctccccagtttaaattagacccccgcctagctcgactcctgggcatccatacccagactcgtccagtgatcatccaagcactgtggcaatatattaagacacataagctccaggaccctcacgagcgggagtttgtcatctgtgacaagtacctgcagcagatctttgagtctcaacgtatgaagttttcagagatccctcagcggctccatgccttgcttatgccaccagaacctatcatcattaatcatgtcatcagtgttgacccgaatgatcagaaaaagacagcttgttatgacattgatgttgaagtggatgacaccttgaagacccagatgaattcttttctgctgtccactgccagccaacaggagattgctactctagacaacaagatccatgagacaatagaaaccatcaaccagctgaagactcagcgggagttcatgctgagctttgccagagaccctcagggtttcatcaatgactggcttcagtcccagtgcagggacctcaagacaatgactgatgtggtgggtaacccagaggaggagcgccgagctgagttctacttccagccctgggctcaggaggctgtgtgccgatacttctactccaaggtgcagcagagacgacaagaattagagcaagccctgggaatccggaatacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11

Buy SMARCD1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Gene now

Add to cart