GJB4-gap junction protein, beta 4, 30.3kDa Gene View larger

GJB4-gap junction protein, beta 4, 30.3kDa Gene

PTXBC034709

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB4-gap junction protein, beta 4, 30.3kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GJB4-gap junction protein, beta 4, 30.3kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034709
Product type: DNA & cDNA
Ncbi symbol: GJB4
Origin species: Human
Product name: GJB4-gap junction protein, beta 4, 30.3kDa Gene
Size: 2ug
Accessions: BC034709
Gene id: 127534
Gene description: gap junction protein, beta 4, 30.3kDa
Synonyms: CX30.3; EKV; gap junction beta-4 protein; connexin 30.3; gap junction protein, beta 4, 30.3kDa; gap junction protein beta 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactgggcatttctgcagggcctgctgagtggcgtgaacaagtactccacagtgctgagccgcatctggctgtctgtggtgttcatctttcgtgtgctggtgtacgtggtggcagcggaggaggtgtgggacgatgagcagaaggactttgtctgcaacaccaagcagcccggctgccccaacgtctgctatgacgagttcttccccgtgtcccacgtgcgcctctgggccctacagctcatcctggtcacgtgcccctcactgctcgtggtcatgcacgtggcctaccgcgaggaacgcgagcgcaagcaccacctgaaacacgggcccaatgccccgtccctgtacgacaacctgagcaagaagcggggcggactgtggtggacgtacttgctgagcctcatcttcaaggccgccgtggatgctggcttcctctatatcttccaccgcctctacaaggattatgacatgccccgcgtggtggcctgctccgtggagccttgcccccacactgtggactgttacatctcccggcccacggagaagaaggtcttcacctacttcatggtgaccacagctgccatctgcatcctgctcaacctcagtgaagtcttctacctggtgggcaagaggtgcatggagatcttcggccccaggcaccggcggcctcggtgccgggaatgcctacccgatacgtgcccaccatatgtcctctcccagggagggcaccctgaggatgggaactctgtcctaatgaaggctgggtcggccccagtggatgcaggtgggtatccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 69
- endoplasmic reticulum protein 27 kDa
- 5'-nucleotidase, cytosolic III-like
- chromosome 7 open reading frame 42

Buy GJB4-gap junction protein, beta 4, 30.3kDa Gene now

Add to cart