Login to display prices
Login to display prices
NT5C3L-5'-nucleotidase, cytosolic III-like Gene View larger

NT5C3L-5'-nucleotidase, cytosolic III-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NT5C3L-5'-nucleotidase, cytosolic III-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NT5C3L-5'-nucleotidase, cytosolic III-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014132
Product type: DNA & cDNA
Ncbi symbol: NT5C3L
Origin species: Human
Product name: NT5C3L-5'-nucleotidase, cytosolic III-like Gene
Size: 2ug
Accessions: BC014132
Gene id: 115024
Gene description: 5'-nucleotidase, cytosolic III-like
Synonyms: NT5C3L; cN-IIIB; 7-methylguanosine phosphate-specific 5'-nucleotidase; 5'-nucleotidase, cytosolic III-like; 7-methylguanosine nucleotidase; N(7)-methylguanylate 5'-phosphatase; cN-III-like protein; cytosolic 5'-nucleotidase 3B; cytosolic 5'-nucleotidase III-like protein; 5'-nucleotidase, cytosolic IIIB
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggccacggtcctgatgcggcagcctgggcgggtgcaggagatcgtgggcgccctccgcaagggcggcggagaccggttacaggtgatttctgattttgacatgaccttgagcaggtttgcatataatggaaagcgatgcccttcttcttacaatattctggataatagcaagatcatcagtgaggagtgtcggaaagagctcacagcgctccttcaccactattacccaattgagatcgacccacaccggaccgtcaaggagaagctacctcatatggtggaatggtggaccaaagcgcacaatctcctatgtcagcagaagattcagaagtttcagatagcccaggtggttagagagtccaatgcaatgctcagggagggatataagaccttcttcaacacactctaccataacaacattccccttttcatcttttctgcgggcattggtgatatcctggaagaaattatccgacagatgaaagtgttccaccccaacatccacatcgtgtctaactacatggattttaatgaagatggttttctccagggatttaagggccagctgatacacacatacaacaagaacagctctgtgtgtgagaactgtggttacttccagcaacttgagggcaaaaccaatgtcatcctgctgggagactctatcggggacctcaccatggccgatggggttcctggtgtgcagaacattctcaaaattggcttcctgaatgacaaggtggaggagcggcgggagcgctacatggactcctatgacatcgtgctggagaaggacgagactctggatgtggtcaacgggctactgcagcacatcctgtgccagggggtccagctggagatgcaaggcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 42
- forty-two-three domain containing 1
- chromosome 1 open reading frame 56
- leucine carboxyl methyltransferase 1