LCMT1-leucine carboxyl methyltransferase 1 Gene View larger

LCMT1-leucine carboxyl methyltransferase 1 Gene

PTXBC014217

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LCMT1-leucine carboxyl methyltransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LCMT1-leucine carboxyl methyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014217
Product type: DNA & cDNA
Ncbi symbol: LCMT1
Origin species: Human
Product name: LCMT1-leucine carboxyl methyltransferase 1 Gene
Size: 2ug
Accessions: BC014217
Gene id: 51451
Gene description: leucine carboxyl methyltransferase 1
Synonyms: CGI-68; LCMT; PPMT1; leucine carboxyl methyltransferase 1; [Phosphatase 2A protein]-leucine-carboxy methyltransferase 1; [phosphatase 2A protein]-leucine-carboxy methyltransferase; protein phosphatase methyltransferase 1; protein-leucine O-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttccctgtgcaagagaactcccatcagcagcgcccgacagcactctcctcctcactgcccaacactgggtggcaaatcttttcatcttggccactctgataggctggacagtgaggtccttcttcctagggcgcatggaaacctgttgcagtcacctgggtttgcggagtgggaggaggtttgcagtaagcattggctactggcatgacccttacatacagcactttgtgagactgtctaaagagaggaaagcccctgaaatcaacagaggatattttgctcgagtccatggtgtcagtcagcttataaaggcatttctacggaagacagaatgtcattgtcaaattgtcaaccttggggcaggcatggataccaccttctggagattaaaggatgaagatcttctcccaagtaaatattttgaggttgactttccaatgattgtcacgagaaagctgcacagtatcaaatgcaagcctcccctatccagccccattctagaactgcattcagaggacacacttcagatggatggacacatactggattcaaagagatatgccgttattggagcagatctccgagacctgtctgaactggaagagaagctaaagaaatgtaacatgaatacacaattgccaacactcctgatagctgaatgtgtgctggtttacatgactccagagcagtccgcaaacctcctgaagtgggcagccaacagttttgagagagccatgttcataaactacgaacaggtgaacatgggtgatcggtttgggcagatcatgattgaaaacctgcggagacgccagtgtgacctggcgggagtggagacctgcaagtcattagagtcacagaaagaacggctcctgtcgaatgggtgggaaacagcatcggccgtcgacatgatggagttgtacaacaggttacctcgagctgaagtgagcaggatagaatcacttgaattcctggatgaaatggagctgctggagcagctcatgcggcattactgcctttgctgggcaaccaaaggaggaaatgagcttgggctgaaggagataacttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 79
- actin, alpha 2, smooth muscle, aorta
- chromosome 1 open reading frame 59
- inositol polyphosphate-1-phosphatase

Buy LCMT1-leucine carboxyl methyltransferase 1 Gene now

Add to cart