Cart 4 Product Products 460,34 € (empty)
-
1 x EIF1AX-euk...113,40 € -
1 x STRADA-STE...113,40 € -
-
1 x WBP1-WW...121,50 €
No products
To be determined Shipping
460,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 460,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 460,34 €
Data sheet of LCMT1-leucine carboxyl methyltransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LCMT1-leucine carboxyl methyltransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014217 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LCMT1 |
| Origin species: | Human |
| Product name: | LCMT1-leucine carboxyl methyltransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC014217 |
| Gene id: | 51451 |
| Gene description: | leucine carboxyl methyltransferase 1 |
| Synonyms: | CGI-68; LCMT; PPMT1; leucine carboxyl methyltransferase 1; [Phosphatase 2A protein]-leucine-carboxy methyltransferase 1; [phosphatase 2A protein]-leucine-carboxy methyltransferase; protein phosphatase methyltransferase 1; protein-leucine O-methyltransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttccctgtgcaagagaactcccatcagcagcgcccgacagcactctcctcctcactgcccaacactgggtggcaaatcttttcatcttggccactctgataggctggacagtgaggtccttcttcctagggcgcatggaaacctgttgcagtcacctgggtttgcggagtgggaggaggtttgcagtaagcattggctactggcatgacccttacatacagcactttgtgagactgtctaaagagaggaaagcccctgaaatcaacagaggatattttgctcgagtccatggtgtcagtcagcttataaaggcatttctacggaagacagaatgtcattgtcaaattgtcaaccttggggcaggcatggataccaccttctggagattaaaggatgaagatcttctcccaagtaaatattttgaggttgactttccaatgattgtcacgagaaagctgcacagtatcaaatgcaagcctcccctatccagccccattctagaactgcattcagaggacacacttcagatggatggacacatactggattcaaagagatatgccgttattggagcagatctccgagacctgtctgaactggaagagaagctaaagaaatgtaacatgaatacacaattgccaacactcctgatagctgaatgtgtgctggtttacatgactccagagcagtccgcaaacctcctgaagtgggcagccaacagttttgagagagccatgttcataaactacgaacaggtgaacatgggtgatcggtttgggcagatcatgattgaaaacctgcggagacgccagtgtgacctggcgggagtggagacctgcaagtcattagagtcacagaaagaacggctcctgtcgaatgggtgggaaacagcatcggccgtcgacatgatggagttgtacaacaggttacctcgagctgaagtgagcaggatagaatcacttgaattcctggatgaaatggagctgctggagcagctcatgcggcattactgcctttgctgggcaaccaaaggaggaaatgagcttgggctgaaggagataacttattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 8 open reading frame 79 - actin, alpha 2, smooth muscle, aorta - chromosome 1 open reading frame 59 - inositol polyphosphate-1-phosphatase |