C8orf79-chromosome 8 open reading frame 79 Gene View larger

C8orf79-chromosome 8 open reading frame 79 Gene

PTXBC016633

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf79-chromosome 8 open reading frame 79 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf79-chromosome 8 open reading frame 79 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016633
Product type: DNA & cDNA
Ncbi symbol: C8orf79
Origin species: Human
Product name: C8orf79-chromosome 8 open reading frame 79 Gene
Size: 2ug
Accessions: BC016633
Gene id: 57604
Gene description: chromosome 8 open reading frame 79
Synonyms: C8orf79; TRM9L
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtatgtgacaaccttaatctcccctttagggatgagggcttcgatgccatcatctccataggagtcatacatcatttttctacaaaacaaagaagaatcagagcaataaaagaaatggccagggtcttagttcccggaggccaactgatgatttacgtttgggcaatggaacaaaagaaccgtcgctttgagaagcaagacgtgcttgttccatggaacagggccctgtgttcccagctcttctcagagtccagccagtctgggaggaagaggcagtgtggatacccagaaagaggccatccctaccatcctccttgctctgagtgtagctgttctgtttgttttaaagagcagggtggttcaaaacggtcccacagtgtgggctatgaacctgctatggcaagaacctgttttgcaaatatttctaaggaaggcgaggaagaatatggattttacagcacattaggaaaatcgtttcgttcctggtttttctccagatctttggatgaatcgactctgaggaagcaaattgaaagagtaagacccttgaaaaacacagaagtttgggccagtagcactgtaacagtccagccttccagacactctagtctagactttgatcaccaagagccattttcaacaaaagagcaaagtttagatgaggaagtgtttgtggaatcttcttctggaaaacacttggagtggctgagagcaccaggcactctgaaacatttaaatggagaccatcaaggggaaatgaggagaaatggagggggaaattttctggatagcactaatactggtgtgaattgtgtggatgcaggcaacatagaagatgataatccttctgctagtaaaatattgagaaggatttctgcagtcgattccacagatttcaacccagatgatacaatgtctgtcgaagatccacagactgatgttttggactccacagcctttatgcgctactaccatgtgtttcgagaaggggagctctgcagtctgctcaaggagaatgtgtcagagctccgtatcctgagttctgggaatgatcatggtaactggtgtatcattgcagagaaaaagggaggttgtgattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin, alpha 2, smooth muscle, aorta
- chromosome 1 open reading frame 59
- inositol polyphosphate-1-phosphatase
- chromosome 1 open reading frame 94

Buy C8orf79-chromosome 8 open reading frame 79 Gene now

Add to cart