ACTA2-actin, alpha 2, smooth muscle, aorta Gene View larger

ACTA2-actin, alpha 2, smooth muscle, aorta Gene

PTXBC017554

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTA2-actin, alpha 2, smooth muscle, aorta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTA2-actin, alpha 2, smooth muscle, aorta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017554
Product type: DNA & cDNA
Ncbi symbol: ACTA2
Origin species: Human
Product name: ACTA2-actin, alpha 2, smooth muscle, aorta Gene
Size: 2ug
Accessions: BC017554
Gene id: 59
Gene description: actin, alpha 2, smooth muscle, aorta
Synonyms: AAT6; ACTSA; MYMY5; actin, aortic smooth muscle; alpha-cardiac actin; cell growth-inhibiting gene 46 protein; actin, alpha 2, smooth muscle, aorta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgaagaagaggacagcactgccttggtgtgtgacaatggctctgggctctgtaaggccggctttgctggggacgatgctcccagggctgttttcccatccattgtgggacgtcccagacatcagggggtgatggtgggaatgggacaaaaagacagctacgtgggtgacgaagcacagagcaaaagaggaatcctgaccctgaagtacccgatagaacatggcatcatcaccaactgggacgacatggaaaagatctggcaccactctttctacaatgagcttcgtgttgcccctgaagagcatcccaccctgctcacggaggcacccctgaaccccaaggccaaccgggagaaaatgactcaaattatgtttgagactttcaatgtcccagccatgtatgtggctatccaggcggtgctgtctctctatgcctctggacgcacaactggcatcgtgctggactctggagatggtgtcacccacaatgtccccatctatgagggctatgccttgccccatgccatcatgcgtctggatctggctggccgagatctcactgactacctcatgaagatcctgactgagcgtggctattccttcgttactactgctgagcgtgagattgtccgggacatcaaggagaaactgtgttatgtagctctggactttgaaaatgagatggccactgccgcatcctcatcctcccttgagaagagttacgagttgcctgatgggcaagtgatcaccatcggaaatgaacgtttccgctgcccagagaccctgttccagccatccttcatcgggatggagtctgctggcatccatgaaaccacctacaacagcatcatgaagtgtgatattgacatcaggaaggacctctatgctaacaatgtcctatcagggggcaccactatgtaccctggcattgccgaccgaatgcagaaggagatcacggccctagcacccagcaccatgaagatcaagatcattgcccctccggagcgcaaatactctgtctggatcggtggctccatcctggcctctctgtccaccttccagcagatgtggatcagcaaacaggaatacgatgaagccgggccttccattgtccaccgcaaatgcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 59
- inositol polyphosphate-1-phosphatase
- chromosome 1 open reading frame 94
- nuclear prelamin A recognition factor

Buy ACTA2-actin, alpha 2, smooth muscle, aorta Gene now

Add to cart