C1orf94-chromosome 1 open reading frame 94 Gene View larger

C1orf94-chromosome 1 open reading frame 94 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf94-chromosome 1 open reading frame 94 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf94-chromosome 1 open reading frame 94 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007637
Product type: DNA & cDNA
Ncbi symbol: C1orf94
Origin species: Human
Product name: C1orf94-chromosome 1 open reading frame 94 Gene
Size: 2ug
Accessions: BC007637
Gene id: 84970
Gene description: chromosome 1 open reading frame 94
Synonyms: uncharacterized protein C1orf94; chromosome 1 open reading frame 94
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgttatcagcagcaggcaggactgtgattctgccacttctactgtcacagacattctgtgtgccgccgaggtcaagagcagcaaggggacagaggacagaggccgcatcctaggtgactccaacttggaagtcagcaagcttctgtcccagttcccactgaagtccactgagacatccaaggtccctgacaacaagaatgtgctggacaagacaagggtcaccaaggacttcctacaggacaacctgttcagtggccctggacccaaggagcccacagggctgagcccatttctgctgctgcctccccgacctcctcctgcacgtcctgagaagctccctgagctccctgctcagaagaggcagctcccagtgtttgccaagatctgttccaagcccaaggctgaccctgctgtggagaggcaccacttgatggaatggagccctggcaccaaggagccaaaaaagggtcaagggagcctctttctcagccagtggccccagagccagaaggacgcctgtggtgaggagggttgctgtgacgcagtgggcaccgcatcactgaccctgccgcccaagaaacctacatgtccagccgagaagaacttgctctatgagttccttggggccaccaagaacccaagcgggcagccgagacttcgaaacaaagtggaagtggatgggccggagctgaaatttaacgcacctgtgacggttgctgacaagaacaacccgaagtacacagggaatgttttcactccacactttcctacagccatgacctcagcaaccctgaaccagccactctggctcaacctgaactatccacctccaccagtgttcacgaatcactctaccttcttgcagtatcagggcctgtacccacagcaggcagcgaggatgccctatcagcaggctttgcacccgcagctgggatgttactcccaacaggtgatgccatacaacccacagcagatgggacagcagatcttccgctcttcctacacccctctgctgagctacatcccttttgtccagcccaattatccctaccctcagaggacacctccaaagatgtctgccaacccccgagaccctcccctaatggcaggagatggaccgcagtacctctttccccaaggatatgggttcggctcgacatccggagggcccttgatgcacagcccctatttttcttccagtgggaatggcataaacttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear prelamin A recognition factor
- chromosome 2 open reading frame 24
- basic leucine zipper and W2 domains 2
- basic leucine zipper and W2 domains 2

Buy C1orf94-chromosome 1 open reading frame 94 Gene now

Add to cart