Login to display prices
Login to display prices
C2orf24-chromosome 2 open reading frame 24 Gene View larger

C2orf24-chromosome 2 open reading frame 24 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf24-chromosome 2 open reading frame 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf24-chromosome 2 open reading frame 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001393
Product type: DNA & cDNA
Ncbi symbol: C2orf24
Origin species: Human
Product name: C2orf24-chromosome 2 open reading frame 24 Gene
Size: 2ug
Accessions: BC001393
Gene id: 27013
Gene description: chromosome 2 open reading frame 24
Synonyms: C2orf24; CGI-57; protein CNPPD1; cyclin Pas1/PHO80 domain-containing protein 1; cyclin Pas1/PHO80 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctgaccgggctcctgctggacgaagaaggcaccttctccctcgccggcttccaggacttcacgttcctcccaggacaccagaagctgagtgcccggatccgaaggaggctctactatggctgggactgggaagccgactgtagcctggaggagctctccagcccggtggcagacattgctgtcgaactgctccagaaggcagcccccagccctattcgccgactccagaagaaatacgtagctcatgtgtcccgggaggcatgcatctccccatgtgctatgatgctggctctggtgtacattgaacggctccggcaccgaaacccagactacttgcagcatgtgtcatcctctgacttgttcctgatctccatgatggtggccagtaagtacctctatgatgaaggggaggaggaggaggtcttcaacgacgaatggggagctgctgggggtgtggccgtgcccactctcaatgccttggagaggggcttcctgagtgccatggattggcatctctacactgaccctcgggagatctttgaggtgctgagctggttggagagctgtgtggctgagcagcagggacggtggcgaggctggtacacctacacagacctgtgtgtgctgctggagcagccgacctggcagttggccctgggctccctctgccagcggctggtaaagctgtcttgcctgttagctgtggcatatgtgagcagtgtggccctggctgtggcatcggtggccgtaatacatcagtctttggggctgtcctgcacccctacacctgggccgcctgaccttggactgacctcccgttgcctcctggagccctgcataccttctgtgccacaatgcctgccgtctcccgctaatgtctccagctgcctggaaggcagcatggggctgcggtcactctggggcagtcttctggcctcactgactcctccaccattgcctcccccagacccccctgctcctcccactcttcttcataactgccacctttgccagaagctccagagagactccccaacctgccatgcctgcctccaccccaaccgtacagtccccactgcgctgtccagcccctggtaccatacctatggcctggctcccccctggccttggagcccggtgcccctttcacttcctcagcctcagcaatgttcccttttcagtgtcatggagctggctcgcctcaagtctttcgttttcccaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - basic leucine zipper and W2 domains 2
- basic leucine zipper and W2 domains 2
- splicing factor 3b, subunit 4, 49kDa
- chromosome 3 open reading frame 39