BZW2-basic leucine zipper and W2 domains 2 Gene View larger

BZW2-basic leucine zipper and W2 domains 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BZW2-basic leucine zipper and W2 domains 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BZW2-basic leucine zipper and W2 domains 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003056
Product type: DNA & cDNA
Ncbi symbol: BZW2
Origin species: Human
Product name: BZW2-basic leucine zipper and W2 domains 2 Gene
Size: 2ug
Accessions: BC003056
Gene id: 28969
Gene description: basic leucine zipper and W2 domains 2
Synonyms: HSPC028; MST017; MSTP017; basic leucine zipper and W2 domain-containing protein 2; basic leucine zipper and W2 domains 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaataagcatcagaagccagtgctaacaggccagcggttcaaaactcggaaaagggatgaaaaagagaaattcgaacccacagtcttcagggatacacttgtccaggggcttaatgaggctggtgatgaccttgaagctgtagccaaatttctggactctacaggctcaagattagattatcgtcgctatgcagacacactcttcgatatcctggtggctggcagtatgcttgcccctggaggaacgcgcatagatgatggtgacaagaccaagatgaccaaccactgtgtgttttcagcaaatgaagatcatgaaaccatccgaaactatgctcaggtcttcaataaactcatcaggagatataagtatttggagaaggcatttgaagatgaaatgaaaaagcttctcctcttccttaaagccttttccgaaacagagcagacaaagttggcgatgctgtcggggattctgctgggcaatggcaccctgcccgccaccatcctcaccagtctcttcaccgacagcttagtcaaagaaggcattgcggcctcatttgctgtcaagcttttcaaagcatggatggcagaaaaagatgccaactctgttacctcgtctttgagaaaagccaacttagacaagaggctgcttgaactctttccagttaacagacagagtgtggatcattttgctaaatacttcactgacgcaggtcttaaggagctttccgacttcctccgagtccagcagtccctgggcaccaggaaggaactgcagaaggagctccaggagcgtctttctcaggaatgcccgatcaaggaggtggtgctttatgtcaaagaagaaatgaagaggaatgatcttccagaaacagcagtgattggtcttctgtggacatgtataatgaacgctgttgagtggaacaagaaggaagaacttgttgcagagcaggctctgaagcacctgaagcaatatgctcccctgctggccgtgttcagctcccaaggccagtcagagctgatcctcctccagaaggttcaggaatactgctacgacaacatccatttcatgaaagcctttcagaagattgtggttctcttttataaagctgatgttctgagcgaagaagcaatactgaaatggtataaggaagcacatgttgctaaaggcaaaagtgtttttcttgaccagatgaagaaatttgttgagtggttacaaaatgcagaagaagaatccgaatcggaaggtgaggaaaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - splicing factor 3b, subunit 4, 49kDa
- chromosome 3 open reading frame 39
- chromosome 5 open reading frame 22
- solute carrier family 38, member 7

Buy BZW2-basic leucine zipper and W2 domains 2 Gene now

Add to cart