SF3B4-splicing factor 3b, subunit 4, 49kDa Gene View larger

SF3B4-splicing factor 3b, subunit 4, 49kDa Gene

PTXBC004273

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SF3B4-splicing factor 3b, subunit 4, 49kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SF3B4-splicing factor 3b, subunit 4, 49kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004273
Product type: DNA & cDNA
Ncbi symbol: SF3B4
Origin species: Human
Product name: SF3B4-splicing factor 3b, subunit 4, 49kDa Gene
Size: 2ug
Accessions: BC004273
Gene id: 10262
Gene description: splicing factor 3b, subunit 4, 49kDa
Synonyms: AFD1; Hsh49; SAP49; SF3b49; splicing factor 3B subunit 4; SAP 49; SF3b50; pre-mRNA-splicing factor SF3b 49 kDa subunit; spliceosomal protein; spliceosome-associated protein (U2 snRNP); spliceosome-associated protein 49; splicing factor 3b, subunit 4, 49kD; splicing factor 3b, subunit 4, 49kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccgggccgatctccgagcggaatcaggatgccactgtgtacgtggggggcctggatgagaaggttagtgaaccgctgctgtgggaactgtttctccaggctggaccagtagtcaacacccacatgccaaaggatagagtcactggccagcaccaaggctatggctttgtggaattcttgagtgaggaagatgctgactatgccattaagatcatgaacatgatcaaactctatgggaagccaatacgggtgaacaaagcatcagctcacaacaaaaacctggatgtaggggccaacattttcattgggaacctggaccctgagattgatgagaagttgctttatgatactttcagcgcctttggggtcatcttacaaacccccaaaattatgcgggaccctgacacaggcaactccaaaggttatgcctttattaattttgcttcatttgatgcttcggatgcagcaattgaagccatgaatgggcagtacctctgtaaccgtcctatcaccgtatcttatgccttcaagaaggactccaagggtgagcgccatggctcagcagccgaacgacttctggcagctcagaacccgctctcccaggctgatcgccctcatcagctgtttgcagatgcacctcctccaccctctgctcccaatcctgtggtatcatcattggggtctgggcttcctccaccaggcatgcctcctcctggctccttcccacccccagtgccacctcctggagccctcccacctgggatacccccagccatgcccccaccacctatgcctcctggggctgcaggacatggccccccatcggcaggaaccccaggggcaggacatcctggtcatggacactcacatcctcacccattcccaccgggtgggatgccccatccagggatgtctcagatgcagcttgcacaccatggccctcatggcttaggacatccccacgctggacccccaggctctgggggccagccaccgccccgaccaccacctggaatgcctcatcctggacctcctccaatgggcatgcccccccgagggcctccattcggatctcccatgggtcacccaggtcctatgcctccgcatggtatgcgtggacctcctccactgatgcccccccatggatacactggccctccacgacccccaccctatggctaccagcgggggcctctccctccacccagacccactccccggccaccagttccccctcgaggcccacttcgaggccctctccctcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 39
- chromosome 5 open reading frame 22
- solute carrier family 38, member 7
- solute carrier family 38, member 5

Buy SF3B4-splicing factor 3b, subunit 4, 49kDa Gene now

Add to cart