C5orf22-chromosome 5 open reading frame 22 Gene View larger

C5orf22-chromosome 5 open reading frame 22 Gene

PTXBC021215

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf22-chromosome 5 open reading frame 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf22-chromosome 5 open reading frame 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021215
Product type: DNA & cDNA
Ncbi symbol: C5orf22
Origin species: Human
Product name: C5orf22-chromosome 5 open reading frame 22 Gene
Size: 2ug
Accessions: BC021215
Gene id: 55322
Gene description: chromosome 5 open reading frame 22
Synonyms: UPF0489 protein C5orf22; chromosome 5 open reading frame 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgactccgcgggagggcgcgctggtctccggcgttaccccaagctcccagtgtgggtggtggaggatcatcaggaggttctaccctttatataccgggccataggctcaaagcatcttcctgccagtaatgtaagttttttacatttcgactcacatccagacctccttattcctgtgaatatgccagcagacaccgtgtttgataaggaaacactctttggagaattaagtattgaaaattggattatgcctgcagtttatgctggccatttttcacatgtaatatggtttcatcccacatgggctcagcagatcagagagggcagacaccactttttagtaggcaaagacacttctaccacaacaatcagggttacaagtacagatcattatttcctaagtgatggtctgtatgtacctgaagaccagctagagaaccaaaaacctttacaattggatgtaattatggtaaaaccttataaactctgtaacaatcaagaagaaaacgatgcagtgtcttctgctaagaaaccaaagctagccctggaagattcggaaaacactgcctctactaactgtgactcttcttcagaaggactggaaaaggacacagcaacacagagaagtgaccagacttgcctagaaccatcatgttcatgttcttctgaaaatcaggaatgccagactgctgccagcactggggaaattctggaaattttgaagaaagggaaggcatttgttttagatattgacttggattttttttcagtcaagaatcccttcaaagaaatgttcactcaggaagagtacaaaatcttacaagagctgtaccaatttaagaaacctggcaccaacctaacagaggaagatttggtagatattgttgatactcgaattcatcaattagaggatttagaagccactttcgctgatttgtgtgatggtgatgatgaagaaacggtacagagatgggcttcaaaccctggaatggaatcactagttccccttgtacagagtttgaaaaaacggatggaagtaccagactatgaaatggttcaccaggctggtttaacctgcgattattcagaacttcctcaccatatcagcacagaacaagaaatagagtgtcttattcaatctgtgcattatttgctgaaaaatttaccaaatcctactcttgtgacaattgcaaggtcaagtctggatgattactgtccttctgaccaagttgacactattcaagaaaaggtcctcaatatgctacgtgccctctatggaaatctagacctccaagtgtatgcagcagagtctcctccatcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 38, member 7
- solute carrier family 38, member 5
- meiosis-specific nuclear structural 1
- splicing factor 3a, subunit 3, 60kDa

Buy C5orf22-chromosome 5 open reading frame 22 Gene now

Add to cart