SF3A3-splicing factor 3a, subunit 3, 60kDa Gene View larger

SF3A3-splicing factor 3a, subunit 3, 60kDa Gene

PTXBC002395

New product

Data sheet of SF3A3-splicing factor 3a, subunit 3, 60kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SF3A3-splicing factor 3a, subunit 3, 60kDa Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC002395
Product type: DNA & cDNA
Ncbi symbol: SF3A3
Origin species: Human
Product name: SF3A3-splicing factor 3a, subunit 3, 60kDa Gene
Size: 2ug
Accessions: BC002395
Gene id: 10946
Gene description: splicing factor 3a, subunit 3, 60kDa
Synonyms: PRP9; PRPF9; SAP61; SF3a60; splicing factor 3A subunit 3; SAP 61; pre-mRNA splicing factor SF3a (60kD); spliceosome associated protein 61; splicing factor 3a, subunit 3, 60kD; splicing factor 3a, subunit 3, 60kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgagggatttgtatgatgataaggatggattacgaaaggaggagctcaatgccatttcaggacccaatgagtttgctgaattctataatagactcaagcaaataaaggaattccaccggaagcacccaaatgagatctgtgtgccaatgtcagtggaatttgaggaactcctgaaggctcgagagaatccaagtgaagaggcacaaaacttggtggagttcacagatgaagagggatatggtcgttatctcgatctccatgactgttacctcaagtacattaacctgaaggcatctgagaagctggattatatcacatacctgtccatctttgaccaattatttgacattcctaaagaaaggaagaatgcagagtataagagatacctagagatgctgcttgagtaccttcaggattacacagatagagtgaagcctctccaagatcagaatgaactttttgggaagattcaggctgagtttgagaagaaatgggagaatgggacctttcctggatggccgaaagagacaagcagtgccctgacccatgctggagcccatcttgacctctctgcattctcctcctgggaggagttggcttctctgggtttggacagattgaaatctgctctcttagctttaggcttgaaatgtggcgggaccctagaagagcgagcccagagactattcagtaccaaaggaaagtccctggagtcacttgatacctctttgtttgccaaaaatcccaagtcaaagggcaccaagcgagacactgaaaggaacaaagacattgcttttctagaagcccagatctatgaatatgtagagattctcggggaacagcgacatctcactcatgaaaatgtacagcgcaagcaagccaggacaggagaagagcgagaagaagaggaagaagagcagatcagtgagagtgagagtgaagatgaagagaacgagatcatttacaaccccaaaaacctgccacttggctgggatggcaaacctattccctactggctgtataagcttcatggcctaaatatcaactacaactgtgagatttgtggaaactacacctaccgagggcccaaagccttccagcgacactttgctgaatggcgtcatgctcatggcatgaggtgtttgggcatcccaaacactgctcactttgctaatgtgacacagattgaagatgctgtctccttgtgggccaaactgaaattgcagaaggcttcagaacgatggcagcctgacactgaggaagaatatgaagactcaagtgggaatgttgtgaataagaagacatacgaggatctgaaaagacaaggactgctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear prelamin A recognition factor
- solute carrier family 41, member 3
- chromosome 2 open reading frame 65
- poly-U binding splicing factor 60KDa

Buy SF3A3-splicing factor 3a, subunit 3, 60kDa Gene now

Add to cart