C1orf56-chromosome 1 open reading frame 56 Gene View larger

C1orf56-chromosome 1 open reading frame 56 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf56-chromosome 1 open reading frame 56 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf56-chromosome 1 open reading frame 56 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002469
Product type: DNA & cDNA
Ncbi symbol: C1orf56
Origin species: Human
Product name: C1orf56-chromosome 1 open reading frame 56 Gene
Size: 2ug
Accessions: BC002469
Gene id: 54964
Gene description: chromosome 1 open reading frame 56
Synonyms: MENT; protein MENT; methylated in normal thymocytes protein; chromosome 1 open reading frame 56
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccccgccgccggcgcgctgctgtgggtcctgctgctgaatctgggtccccgggcggcgggggcccaaggcctgacccagactccgaccgaaatgcagcgggtcagtttacgctttgggggccccatgacccgcagctaccggagcaccgcccggactggtcttccccggaagacaaggataatcctagaggacgagaatgatgccatggccgacgccgaccgcctggctggaccagcggctgccgagctcttggccgccacggtgtccaccggctttagccggtcgtccgccattaacgaggaggatgggtcttcagaagagggggttgtgattaatgccggaaaggatagcaccagcagagagcttcccagtgcgactcccaatacagcggggagttccagcacgaggtttatagccaatagtcaggagcctgaaatcaggctgacttcaagcctgccgcgctcccccgggaggtctactgaggacctgccaggctcgcaggccaccctgagccagtggtccacacctgggtctaccccgagccggtggccgtcaccctcacccacagccatgccatctcctgaggatctgcggctggtgctgatgccctggggcccgtggcactgccactgcaagtcgggcaccatgagccggagccggtctgggaagctgcacggcctttccgggcgccttcgagttggggcgctgagccagctccgcacggagcacaagccttgcacctatcaacaatgtccctgcaaccgacttcgggaagagtgccccctggacacaagtctctgtactgacaccaactgtgcctctcagagcaccaccagtaccaggaccaccactacccccttccccaccatccacctcagaagcagtcccagcctgccacccgccagcccctgcccagccctggctttttggaaacgggtcaggattggcctggaggatatttggaatagcctctcttcagtgttcacagagatgcaaccaatagacagaaaccagaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine carboxyl methyltransferase 1
- chromosome 8 open reading frame 79
- actin, alpha 2, smooth muscle, aorta
- chromosome 1 open reading frame 59

Buy C1orf56-chromosome 1 open reading frame 56 Gene now

Add to cart