C7orf42-chromosome 7 open reading frame 42 Gene View larger

C7orf42-chromosome 7 open reading frame 42 Gene

PTXBC008675

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf42-chromosome 7 open reading frame 42 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf42-chromosome 7 open reading frame 42 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008675
Product type: DNA & cDNA
Ncbi symbol: C7orf42
Origin species: Human
Product name: C7orf42-chromosome 7 open reading frame 42 Gene
Size: 2ug
Accessions: BC008675
Gene id: 55069
Gene description: chromosome 7 open reading frame 42
Synonyms: UPF0458 protein C7orf42; C7orf42; transmembrane protein 248
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcagcatcaaccccctggagaacctgaaggtgtacatcagcagtcggcctcccctggtggtcttcatgatcagcgtaagcgccatggccatagctttcctgaccctgggctacttcttcaaaatcaaggagattaaatccccagaaatggcagaggattggaatacttttctgctacggttcaatgatttggacttgtgtgtatcagagaatgaaaccctcaagcatctcacaaacgacaccacaactccggaaagtacaatgaccagcgggcaggcccgagcttccacccagtccccccaggccctggaggactcgggcccggtgaatatctcagtctcaatcaccctaaccctggacccactgaaacccttcggagggtattcccgcaacgtcacccatctgtactcaaccatcttagggcatcagattggactttcaggcagggaagcccacgaggagataaacatcaccttcaccctgcctacagcgtggagctcagatgactgcgccctccacggtcactgtgagcaggtggtattcacagcctgcatgaccctcacggccagccctggggtgttccccgtcactgtacagccaccgcactgtgttcctgacacgtacagcaacgccacgctctggtacaagatcttcacaactgccagagatgccaacacaaaatacgcccaagattacaatcctttctggtgttataagggggccattggaaaagtctatcatgctttaaatcccaagcttacagtgattgttccagatgatgaccgttcattaataaatttgcatctcatgcacaccagttacttcctctttgtgatggtgataacaatgttttgctatgctgttatcaagggcagacctagcaaattgcgtcagagcaatcctgaattttgtcccgagaaggtggctttggctgaagcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - forty-two-three domain containing 1
- chromosome 1 open reading frame 56
- leucine carboxyl methyltransferase 1
- chromosome 8 open reading frame 79

Buy C7orf42-chromosome 7 open reading frame 42 Gene now

Add to cart