Login to display prices
Login to display prices
C2orf69-chromosome 2 open reading frame 69 Gene View larger

C2orf69-chromosome 2 open reading frame 69 Gene

PTXBC036456

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf69-chromosome 2 open reading frame 69 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf69-chromosome 2 open reading frame 69 Gene

Proteogenix catalog: PTXBC036456
Ncbi symbol: C2orf69
Product name: C2orf69-chromosome 2 open reading frame 69 Gene
Size: 2ug
Accessions: BC036456
Gene id: 205327
Gene description: chromosome 2 open reading frame 69
Synonyms: UPF0565 protein C2orf69; chromosome 2 open reading frame 69
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcgtcatcctgagaattatcaatgggaaaactggagtctagaaaatgttgctaccattttagcccaccggttccccaatagttatatttgggtgataaaatgttcccgaatgcatttgcacaaattcagctgctatgacaattttgtgaaaagtaacatgtttggtgccccagaacacaatactgactttggagcttttaagcacctttatatgttattagttaatgcttttaatttaagtcagaatagtttatcaaagaaaagtttgaatgtttggaataaggactccatagcatctaactgtagatccagtccttctcatactacgaatggttgccagggagaaaaagtgaggacctgtgaaaaatctgatgagtctgccatgagtttttatccaccatcactaaatgacgcatcttttactttgattggattcagtaaaggttgtgttgttttgaatcagttgctttttgaattgaaagaagccaagaaagacaagaacatagatgcttttatcaaaagcataagaacaatgtattggctggatggtggtcattctggaggaagcaatacttgggttacttatccagaagtcttgaaagaatttgcacaaacaggaattatcgttcacactcatgtaacaccttaccaagtacgtgatccaatgagatcttggattggaaaggagcacaagaaatttgttcagatacttggggatcttggtatgcaggtgactagccaaattcattttacaaaggaagctccttccatagagaatcacttcagggttcatgaagtattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: