C2orf69-chromosome 2 open reading frame 69 Gene View larger

C2orf69-chromosome 2 open reading frame 69 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf69-chromosome 2 open reading frame 69 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf69-chromosome 2 open reading frame 69 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036456
Product type: DNA & cDNA
Ncbi symbol: C2orf69
Origin species: Human
Product name: C2orf69-chromosome 2 open reading frame 69 Gene
Size: 2ug
Accessions: BC036456
Gene id: 205327
Gene description: chromosome 2 open reading frame 69
Synonyms: UPF0565 protein C2orf69; chromosome 2 open reading frame 69
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcgtcatcctgagaattatcaatgggaaaactggagtctagaaaatgttgctaccattttagcccaccggttccccaatagttatatttgggtgataaaatgttcccgaatgcatttgcacaaattcagctgctatgacaattttgtgaaaagtaacatgtttggtgccccagaacacaatactgactttggagcttttaagcacctttatatgttattagttaatgcttttaatttaagtcagaatagtttatcaaagaaaagtttgaatgtttggaataaggactccatagcatctaactgtagatccagtccttctcatactacgaatggttgccagggagaaaaagtgaggacctgtgaaaaatctgatgagtctgccatgagtttttatccaccatcactaaatgacgcatcttttactttgattggattcagtaaaggttgtgttgttttgaatcagttgctttttgaattgaaagaagccaagaaagacaagaacatagatgcttttatcaaaagcataagaacaatgtattggctggatggtggtcattctggaggaagcaatacttgggttacttatccagaagtcttgaaagaatttgcacaaacaggaattatcgttcacactcatgtaacaccttaccaagtacgtgatccaatgagatcttggattggaaaggagcacaagaaatttgttcagatacttggggatcttggtatgcaggtgactagccaaattcattttacaaaggaagctccttccatagagaatcacttcagggttcatgaagtattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endoplasmic reticulum protein 27 kDa
- 5'-nucleotidase, cytosolic III-like
- chromosome 7 open reading frame 42
- forty-two-three domain containing 1

Buy C2orf69-chromosome 2 open reading frame 69 Gene now

Add to cart