Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SRP14-signal recognition particle 14kDa (homologous Alu RNA binding protein) Gene
PTXBC035495
New product
Data sheet of SRP14-signal recognition particle 14kDa (homologous Alu RNA binding protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SRP14-signal recognition particle 14kDa (homologous Alu RNA binding protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035495 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SRP14 |
| Origin species: | Human |
| Product name: | SRP14-signal recognition particle 14kDa (homologous Alu RNA binding protein) Gene |
| Size: | 2ug |
| Accessions: | BC035495 |
| Gene id: | 6727 |
| Gene description: | signal recognition particle 14kDa (homologous Alu RNA binding protein) |
| Synonyms: | ALURBP; signal recognition particle 14 kDa protein; 18 kDa Alu RNA-binding protein; homologous Alu RNA binding protein; signal recognition particle 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgttgttggagagcgagcagttcctgacggagctgaccagacttttccagaagtgccggacgtcgggcagcgtctatatcaccttgaagaagtatgacggtcgaaccaaacccattccaaagaagggtactgtggagggctttgagcccgcagacaacaagtgtctgttaagagctaccgatgggaagaagaagatcagcactgtggtgagctccaaggaagtgaataagtttcagatggcttattcaaacctccttagagctaacatggatgggctgaagaagagagacaaaaagaacaaaactaagaagaccaaagcagcagcagcagcagcagcagcagcacctgccgcagcagcaacagcaccaacaacagcagcaacaacagcagcaacagcagcacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G - X-ray repair complementing defective repair in Chinese hamster cells 2 - X-ray repair complementing defective repair in Chinese hamster cells 1 - nascent-polypeptide-associated complex alpha polypeptide pseudogene 1 |