Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APOBEC3G-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G Gene
PTXBC024268
New product
Data sheet of APOBEC3G-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APOBEC3G-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APOBEC3G |
| Origin species: | Human |
| Product name: | APOBEC3G-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G Gene |
| Size: | 2ug |
| Accessions: | BC024268 |
| Gene id: | 60489 |
| Gene description: | apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G |
| Synonyms: | A3G; ARCD; ARP-9; ARP9; CEM-15; CEM15; MDS019; bK150C2.7; dJ494G10.1; DNA dC->dU-editing enzyme APOBEC-3G; APOBEC-related cytidine deaminase; APOBEC-related protein 9; DNA dC->dU editing enzyme; apolipoprotein B editing enzyme catalytic polypeptide-like 3G; apolipoprotein B mRNA editing enzyme cytidine deaminase; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G; apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G; deoxycytidine deaminase; phorbolin-like protein MDS019; apolipoprotein B mRNA editing enzyme catalytic subunit 3G |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcctcacttcagaaacacagtggagcgaatgtatcgagacacattctcctacaacttttataatagacccatcctttctcgtcggaataccgtctggctgtgctacgaagtgaaaacaaagggtccctcaaggccccctttggacgcaaagatctttcgaggccaggtgtattccgaacttaagtaccacccagagatgagattcttccactggttcagcaagtggaggaagctgcatcgtgaccaggagtatgaggtcacctggtacatatcctggagcccctgcacaaagtgtacaagggatatggccacgttcctggccgaggacccgaaggttaccctgaccatctttgttgcccgcctctactacttctgggacccagattaccaggaggcgcttcgcagcctgtgtcagaaaagagacggtccgcgtgccaccatgaagatcatgaattatgacgaatttcagcactgttggagcaagttcgtgtacagccaaagagagctatttgagccttggaataatctgcctaaatattatatattactgcacatcatgctgggggagattctcagacactcgatggatccacccacattcactttcaactttaacaatgaaccttgggtcagaggacggcatgagacttacctgtgttatgaggtggagcgcatgcacaatgacacctgggtcctgctgaaccagcgcaggggctttctatgcaaccaggctccacataaacacggtttccttgaaggccgccatgcagagctgtgcttcctggacgtgattcccttttggaagctggacctggaccaggactacagggttacctgcttcacctcctggagcccctgcttcagctgtgcccaggaaatggctaaattcatttcaaaaaacaaacacgtgagcctgtgcatcttcactgcccgcatctatgatgatcaaggaagatgtcaggaggggctgcgcaccctggccgaggctggggccaaaatttcaataatgacatacagtgaatttaagcactgctgggacacctttgtggaccaccagggatgtcccttccagccctgggatggactagatgagcacagccaagacctgagtgggaggctgcgggccattctccagaatcaggaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-ray repair complementing defective repair in Chinese hamster cells 2 - X-ray repair complementing defective repair in Chinese hamster cells 1 - nascent-polypeptide-associated complex alpha polypeptide pseudogene 1 - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H |