Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB3-proteasome (prosome, macropain) subunit, beta type, 3 Gene
PTXBC013008
New product
Data sheet of PSMB3-proteasome (prosome, macropain) subunit, beta type, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB3-proteasome (prosome, macropain) subunit, beta type, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013008 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB3 |
| Origin species: | Human |
| Product name: | PSMB3-proteasome (prosome, macropain) subunit, beta type, 3 Gene |
| Size: | 2ug |
| Accessions: | BC013008 |
| Gene id: | 5691 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 3 |
| Synonyms: | HC10-II; proteasome subunit beta type-3; proteasome (prosome, macropain) subunit, beta type, 3; proteasome chain 13; proteasome component C10-II; proteasome theta chain; proteasome subunit beta 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctattatgtcctataacggaggggccgtcatggccatgaaggggaagaactgtgtggccatcgctgcagacaggcgcttcgggatccaggcccagatggtgaccacggacttccagaagatctttcccatgggtgaccggctgtacatcggtctggccgggctcgccactgacgtccagacagttgcccagcgcctcaagttccggctgaacctgtatgagttgaaggaaggtcggcagatcaaaccttataccctcatgagcatggtggccaacctcttgtatgagaaacggtttggcccttactacactgagccagtcattgccgggttggacccgaagacctttaagcccttcatttgctctctagacctcatcggctgccccatggtgactgatgactttgtggtcagtggcacctgcgccgaacaaatgtacggaatgtgtgagtccctctgggagcccaacatggatccggatcacctgtttgaaaccatctcccaagccatgctgaatgctgtggaccgggatgcagtgtcaggcatgggagtcattgtccacatcatcgagaaggacaaaatcaccaccaggacactgaaggcccgaatggactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coenzyme Q3 homolog, methyltransferase (S. cerevisiae) - major histocompatibility complex, class II, DO beta - proline synthetase co-transcribed homolog (bacterial) - cleavage and polyadenylation specific factor 6, 68kDa |