Login to display prices
Login to display prices
PROSC-proline synthetase co-transcribed homolog (bacterial) Gene View larger

PROSC-proline synthetase co-transcribed homolog (bacterial) Gene

PTXBC012334

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PROSC-proline synthetase co-transcribed homolog (bacterial) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PROSC-proline synthetase co-transcribed homolog (bacterial) Gene

Proteogenix catalog: PTXBC012334
Ncbi symbol: PROSC
Product name: PROSC-proline synthetase co-transcribed homolog (bacterial) Gene
Size: 2ug
Accessions: BC012334
Gene id: 11212
Gene description: proline synthetase co-transcribed homolog (bacterial)
Synonyms: proline synthase co-transcribed bacterial homolog protein; proline synthetase co-transcribed (bacterial homolog); proline synthetase co-transcribed bacterial homolog protein; proline synthetase co-transcribed homolog; proline synthetase cotranscribed homolog (bacterial)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggagagctggcagcatgtcggccgagctgggagtcgggtgcgcattgcgggcggtgaacgagcgcgtgcagcaggctgtggcgcggcggccgcgggatctcccagccatccagccccggctagtggcggtcagcaaaaccaaacctgcagacatggtgatcgaggcctatggacatgggcagcgcacttttggcgagaactacgttcaggaactgctagaaaaagcatcaaatcccaaaattctgtctttgtgtcctgagatcaaatggcacttcattggccacctacagaaacaaaatgtcaacaaattgatggctgtccccaatctcttcatgctggaaacagtggattctgtgaagttggcagacaaagtgaacagttcctggcagagaaaaggttctcctgaaaggttaaaggttatggtccagattaacaccagcggagaagagagtaaacatggccttccaccttcagagaccatagccatcgtggagcacataaacgccaagtgtcctaacctggagtttgtggggctgatgaccataggaagctttgggcatgatcttagtcaaggaccaaatccagacttccagctgttattgtccctccgggaggagctgtgtaaaaagctgaacatccctgctgaccaggttgagctgagcatgggcatgtccgcggatttccagcatgcggttgaagtaggatctacaaatgtccgaataggaagcacgatttttggagagcgggattactcaaagaaacccaccccggacaagtgcgcagcagacgtgaaggccccgctggaggtggcacaggagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: