Login to display prices
Login to display prices
CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene View larger

CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene

PTXBC000714

New product

Data sheet of CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC000714
Ncbi symbol: CPSF6
Product name: CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene
Size: 2ug
Accessions: BC000714
Gene id: 11052
Gene description: cleavage and polyadenylation specific factor 6, 68kDa
Synonyms: CFIM; CFIM68; HPBRII-4; HPBRII-7; cleavage and polyadenylation specificity factor subunit 6; CPSF 68 kDa subunit; cleavage and polyadenylation specific factor 6, 68kDa; cleavage and polyadenylation specificity factor 68 kDa subunit; cleavage factor Im complex 68 kDa subunit; pre-mRNA cleavage factor I, 68kD subunit; pre-mRNA cleavage factor Im (68kD); pre-mRNA cleavage factor Im 68 kDa subunit; protein HPBRII-4/7; cleavage and polyadenylation specific factor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacggcgtggaccacatagacatttacgcggatgtcggcgaagagttcaaccaggaagctgaatatggtgggcatgatcagatagatttgtatgacgatgtcatatctccatctgcaaataatggagatgccccagaagaccgagattacatggatactctcccaccaactgttggtgatgatgtgggtaaaggagcagcaccaaatgttgtctatacatatactggaaagagaattgcattatatattggaaatctaacatggtggacaacagatgaagacttaactgaagcagttcattctttgggagtaaatgatattttggagataaaattttttgaaaatcgggcaaatggccagtcaaaggggtttgcccttgttggtgttggatctgaagcatcttcaaaaaagttaatggatctgttacctaaaagagaacttcatggtcagaatcctgttgtaactccatgcaataaacagttcctgagtcaatttgaaatgcagtccaggaaaactacacaatcaggacaaatgtctggggaaggtaaagctggtcctccaggaggcagttcccgtgcagcatttccacaaggtggtagaggacggggccgttttccaggggctgttcctggtggggacagatttcctgggccagcaggaccaggagggccacccccaccttttccaggaaatttgatcaagcatcttgttaaaggaactcggcctttgttcctggaaactaggattccatggcatatggggcacagcatagaggaaatacccatttttggcctaaaagctggacagactccaccacgtccacccttaggtcctccaggcccacctggtccaccaggtcctccacctcctggtcaggttctgcctcctcctctagctgggcctcctaatcgaggagatcgccctccaccaccagttctttttcctggacaaccttttgggcagcctccattgggtccacttcctcctggccctccacctccagttccaggctacggcccccctcctggcccaccacctccacaacagggaccacctccacctccaggcccctttccacctcgtccacccggtccacttgggccaccccttacactagctcctcctccgcatcttcctggaccacctccaggtgccccaccgccagctccgcatgtgaacccagctttctttcctccaccaactaacagtggcatgcctacatcagatagccgaggtccaccaccaacagatccatatgggcgacctccaccatatgataggggtgactatggcccccctggaagggaaatggatactgcaagaacgccattgagtgaagctgaatttgaagaaatcatgaatagaaatagggcaatctcaagcagtgctatttcgagagctgtgtctgatgccagtgctggtgattatgggagtgctattgagacactggtaactgcaatttctttaattaaacaatccaaagtatctgctgatgatcgttgcaaagttcttattagttctttgcaagattgccttcatggaattgagtccaagtcttatggttctggatcaagacgtgaacgatcaagagagagggaccatagtagatcacgagaaaagagtcgacgtcataaatcccgtagtagagaccgtcatgacgattattacagagagagaagcagagaacgagagaggcaccgggatcgtgaccgagaccgtgaccgagagcgtgaccgagagcgcgaatatcgtcatcgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice