HLA-DOB-major histocompatibility complex, class II, DO beta Gene View larger

HLA-DOB-major histocompatibility complex, class II, DO beta Gene

PTXBC006097

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DOB-major histocompatibility complex, class II, DO beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DOB-major histocompatibility complex, class II, DO beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006097
Product type: DNA & cDNA
Ncbi symbol: HLA-DOB
Origin species: Human
Product name: HLA-DOB-major histocompatibility complex, class II, DO beta Gene
Size: 2ug
Accessions: BC006097
Gene id: 3112
Gene description: major histocompatibility complex, class II, DO beta
Synonyms: DOB; HLA class II histocompatibility antigen, DO beta chain; MHC class II antigen DOB; major histocompatibility complex, class II, DO beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttctgggtgggtcccctgggtggtggctctgctagtgaatctgacccgactggattcctccatgactcaaggcacagactctccagaagattttgtgattcaggcaaaggctgactgttacttcaccaacgggacagaaaaggtgcagtttgtggtcagattcatctttaacttggaggagtatgtacgtttcgacagtgatgtggggatgtttgtggcattgaccaagctggggcagccagatgctgagcagtggaacagccggctggatctcttggagaggagcagacaggccgtggatggggtctgtagacacaactacaggctgggcgcacccttcactgtggggagaaaagtgcaaccagaggtgacagtgtacccagagaggaccccactcctgcaccagcataatctgctgcactgctctgtgacaggcttctatccaggggatatcaagatcaagtggttcctgaatgggcaggaggagagagctggggtcatgtccactggccctatcaggaatggagactggacctttcagactgtggtgatgctagaaatgactcctgaacttggacatgtctacacctgccttgtcgatcactccagcctgctgagccctgtttctgtggagtggagagctcagtctgaatattcttggagaaagatgctgagtggcattgcagccttcctacttgggctaatcttccttctggtgggaatcgtcatccagctaagggctcagaaaggatatgtgaggacgcagatgtctggtaatgaggtctcaagagctgttctgctccctcagtcatgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline synthetase co-transcribed homolog (bacterial)
- cleavage and polyadenylation specific factor 6, 68kDa
- eukaryotic translation initiation factor 3, subunit C
- nucleotide-binding oligomerization domain containing 1

Buy HLA-DOB-major histocompatibility complex, class II, DO beta Gene now

Add to cart