Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene
PTXBC034814
New product
Data sheet of TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034814 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRPV6 |
| Origin species: | Human |
| Product name: | TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene |
| Size: | 2ug |
| Accessions: | BC034814 |
| Gene id: | 55503 |
| Gene description: | transient receptor potential cation channel, subfamily V, member 6 |
| Synonyms: | ABP/ZF; CAT1; CATL; ECAC2; HSA277909; LP6728; ZFAB; transient receptor potential cation channel subfamily V member 6; Alu-binding protein with zinc finger domain; calcium transport protein 1; calcium transporter-like protein; epithelial apical membrane calcium transporter/channel CaT1; epithelial calcium channel 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgcttgggcgctcggtctccaccccagggtcataagtggggagagagcccttcccagggcacccaggcaggtgcagggaagtgcagagcttgtggaaagcgtgtgagtgagggagacaggaacggctctgggggtgggaagtggggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa - COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) - required for meiotic nuclear division 5 homolog B (S. cerevisiae) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E |