TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene View larger

TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034814
Product type: DNA & cDNA
Ncbi symbol: TRPV6
Origin species: Human
Product name: TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene
Size: 2ug
Accessions: BC034814
Gene id: 55503
Gene description: transient receptor potential cation channel, subfamily V, member 6
Synonyms: ABP/ZF; CAT1; CATL; ECAC2; HSA277909; LP6728; ZFAB; transient receptor potential cation channel subfamily V member 6; Alu-binding protein with zinc finger domain; calcium transport protein 1; calcium transporter-like protein; epithelial apical membrane calcium transporter/channel CaT1; epithelial calcium channel 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgcttgggcgctcggtctccaccccagggtcataagtggggagagagcccttcccagggcacccaggcaggtgcagggaagtgcagagcttgtggaaagcgtgtgagtgagggagacaggaacggctctgggggtgggaagtggggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
- COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
- required for meiotic nuclear division 5 homolog B (S. cerevisiae)
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E

Buy TRPV6-transient receptor potential cation channel, subfamily V, member 6 Gene now

Add to cart