ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene View larger

ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003679
Product type: DNA & cDNA
Ncbi symbol: ATP5I
Origin species: Human
Product name: ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene
Size: 2ug
Accessions: BC003679
Gene id: 521
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
Synonyms: ATP5K; ATP synthase subunit e, mitochondrial; ATP synthase e chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E; ATPase subunit e; F1F0-ATP synthase, murine e subunit; ATP synthase, H+ transporting, mitochondrial Fo complex subunit E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgccaccggtgcaggtctctccgctcatcaagctcggccgctactccgccctgttcctcggtgtggcctacggagccacgcgctacaattacctaaaacctcgggcagaagaggagaggaggatagcagcagaagagaagaagaagcaggatgaactgaaacggattgccagagaattggcagaagatgacagcatattaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
- translocase of inner mitochondrial membrane 17 homolog B (yeast)
- COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
- intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)

Buy ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene now

Add to cart